Search found 20 matches

by TToe
Fri Nov 23, 2012 4:07 pm
Forum: Genetics
Topic: Sequence allignment questions
Replies: 6
Views: 5977

Re:

The only problem I see is the K-E pair... Yes, the crucial amino acids were (could) not be substituted, but not all identical amino acids are crucial. Do you know, which amino acids belong to small hydrophobic AAs? No because it also appears on the link I gave you below (I'm really confused). In th...
by TToe
Fri Nov 23, 2012 3:51 pm
Forum: Genetics
Topic: Sequence allignment questions
Replies: 6
Views: 5977

Sequence allignment questions

m ':' means Conservative amino acids. As we know it's the replacement of an amino acid residue with another one with similar properties, so why do the amino acids with the ':' below it have different properties (so different colours) (look at link above). Are the absolutely crucial amino acids the a...
by TToe
Fri Nov 23, 2012 6:07 am
Forum: Microbiology
Topic: How can an adenovirus gain the host cell's genetic info
Replies: 1
Views: 2430

in vivo so not through gene therapy.
by TToe
Fri Nov 23, 2012 5:48 am
Forum: Microbiology
Topic: How can an adenovirus gain the host cell's genetic info
Replies: 1
Views: 2430

How can an adenovirus gain the host cell's genetic info

I.e Why would a gene in adenovirus be similar to its host cell gene?
by TToe
Fri Nov 23, 2012 5:21 am
Forum: Microbiology
Topic: Does the adenovirus produce a provirus?
Replies: 0
Views: 2169

Does the adenovirus produce a provirus?

Thanks.
by TToe
Thu Nov 22, 2012 1:03 pm
Forum: Genetics
Topic: Viral DNA in Host DNA?
Replies: 1
Views: 2251

Viral DNA in Host DNA?

When viral DNA integrates in its host DNA and later cleaves to leave the host cell:
- What initiates the response?
- Does the host’s genome get cleaved too?
- What is this process called?
by TToe
Wed Nov 21, 2012 5:22 pm
Forum: Genetics
Topic: Sequence analysis
Replies: 1
Views: 2221

Sequence analysis

Ok, so there's a gene ns5 in chicken virus X that I have to look at. I found the amino acid sequence of the gene and compare this with the amino acid sequences of known proteins (in a database). I has about 200 results of related proteins. The more identities and positives a protein of comparison ha...
by TToe
Tue Nov 20, 2012 1:41 pm
Forum: Genetics
Topic: How do I create the sequence contig of this DNA?
Replies: 2
Views: 3929

How do I create the sequence contig of this DNA?

You have the following sequence reads from the protein-encoding region of a Homo sapiens cDNA clone: Read 1: tattatcctgactttagccatgaatatcatgagtacattgcagtgggctgttaactccagcataga Read 2: caaccaaaccatacaagaatggccaactctcgaaagttatgattattgagaattcacacgtg Read 3: agttatgattattgagaattcacacgtgaagaaagatgacatctg...