Login

|
|
Programming Language of ChoiceModerator: BioTeam
25 posts • Page 1 of 3 • 1, 2, 3
Programming Language of ChoiceWhich is the programming language of choice for doing Bio-informatics research ?
Know thyself.
Does anyone here use programming in biology?
I want to get started with a language but im pretty much a beginner when it comes to programming. So I need something fairly easy. I am fairly confident with computers and this will just be a hobby. for now. I am looking at python as i used it at a workshop i went to and i know its used a lot in biology. I initially want to use for it for Systems Biology. Creating models of pathways and systems. And then making predictions about the pathway etc.
A Simple Perl DNA profile script#!/usr/bin/perl
$dnaseq='ggggaccccattggggcccc'; $counter=0; while($dnaseq=~/a/g){ $counter++; } print 'adenine: '.$counter*100/length($dnaseq).' %'; #the above code wud print the % of adenine in the given DNA sequence #to run the programme save the code in a file 'dnaseq.pl' #and execute it by the command # perl dnaseq.pl Know thyself.
lol. Thats true. Same with systems biology. Should be a problem really, but im not sure it is at the moment. As long as it works.
EEEEEK! A linux zealot! Kill it! Kill it!!!!!!!!!! hahahahaha
Me neither. But if you want to go into pure biology, not medicine, you really need to learn a little programming. It is becoming more and more needed in the biological world. Especially with the advent of bioinformatics.
25 posts • Page 1 of 3 • 1, 2, 3
Who is onlineUsers browsing this forum: No registered users and 0 guests |
© Biology-Online.org. All Rights Reserved. Register | Login | About Us | Contact Us | Link to Us | Disclaimer & Privacy