Login

Join for Free!
17878 members


Programming Language of Choice

Everything on bioinformatics, the science of information technology as applied to biological research.

Moderator: BioTeam

Perl or Java or Awk or Python ?

Poll ended at Wed May 11, 2005 3:54 am

Perl
0
No votes
Java
1
33%
Awk
0
No votes
Python
2
66%
Other(plz Specify)
0
No votes
 
Total votes : 3

Programming Language of Choice

Postby cytochromeP on Wed May 04, 2005 3:54 am

Which is the programming language of choice for doing Bio-informatics research ?
Know thyself.
User avatar
cytochromeP
Death Adder
Death Adder
 
Posts: 73
Joined: Wed Apr 06, 2005 2:17 pm
Location: Third Rock From The Sun

Postby mith on Wed May 04, 2005 4:29 am

Perl and java can be used online, dunno about the others though.
Living one day at a time;
Enjoying one moment at a time;
Accepting hardships as the pathway to peace;
~Niebuhr
User avatar
mith
Inland Taipan
Inland Taipan
 
Posts: 4647
Joined: Thu Jan 20, 2005 8:14 pm
Location: Berkeley, CA

Postby Chris4 on Thu May 05, 2005 9:03 am

Does anyone here use programming in biology?
I want to get started with a language but im pretty much a beginner when it comes to programming. So I need something fairly easy. I am fairly confident with computers and this will just be a hobby. for now.
I am looking at python as i used it at a workshop i went to and i know its used a lot in biology.
I initially want to use for it for Systems Biology. Creating models of pathways and systems. And then making predictions about the pathway etc.
User avatar
Chris4
Coral
Coral
 
Posts: 287
Joined: Mon Mar 07, 2005 4:56 pm
Location: UK

A Simple Perl DNA profile script

Postby cytochromeP on Thu May 05, 2005 12:22 pm

#!/usr/bin/perl

$dnaseq='ggggaccccattggggcccc';

$counter=0;

while($dnaseq=~/a/g){
$counter++;
}

print 'adenine: '.$counter*100/length($dnaseq).' %';

#the above code wud print the % of adenine in the given DNA sequence
#to run the programme save the code in a file 'dnaseq.pl'
#and execute it by the command
# perl dnaseq.pl
Know thyself.
User avatar
cytochromeP
Death Adder
Death Adder
 
Posts: 73
Joined: Wed Apr 06, 2005 2:17 pm
Location: Third Rock From The Sun

Postby ac83 on Sat May 07, 2005 6:19 am

I'm doing a bioinformatics degree in uni right now. It doesn't seem like there's really anyone out there with the training that knows what is going on truly with both the computer side and the bio side.
ac83
Garter
Garter
 
Posts: 10
Joined: Sat May 07, 2005 3:38 am
Location: Sydney

Postby cyberpostdoc on Fri Jun 03, 2005 2:57 am

Perl > java > c/c++

JSP PHP

MySQL oracle
cyberpostdoc
Garter
Garter
 
Posts: 17
Joined: Fri Jun 03, 2005 2:50 am
Location: http://www.cyberpostdoc.org/


Postby Chris4 on Fri Jun 03, 2005 8:39 am

ac83 wrote:I'm doing a bioinformatics degree in uni right now. It doesn't seem like there's really anyone out there with the training that knows what is going on truly with both the computer side and the bio side.


lol. Thats true. Same with systems biology. Should be a problem really, but im not sure it is at the moment. As long as it works. :o
User avatar
Chris4
Coral
Coral
 
Posts: 287
Joined: Mon Mar 07, 2005 4:56 pm
Location: UK

Postby biostudent84 on Mon Jun 13, 2005 6:35 pm

cyberpostdoc wrote:Perl > java > c/c++


EEEEEK! A linux zealot! Kill it! Kill it!!!!!!!!!!

hahahahaha
User avatar
biostudent84
Site Admin
Site Admin
 
Posts: 977
Joined: Thu Nov 11, 2004 6:00 am
Location: Farmville, VA

Postby b_d_41501 on Mon Jun 13, 2005 7:28 pm

I program with Visual Basic 6.0. lol, i know this is different from the topic right?. lol
"Take four red capsules, in ten minutes take two more. Help is on the way."
----- Voice from the Medicine Cabinet
User avatar
b_d_41501
King Cobra
King Cobra
 
Posts: 746
Joined: Mon Apr 25, 2005 9:55 pm
Location: Kentucky

Postby biostudent84 on Mon Jun 13, 2005 7:41 pm

b_d_41501 wrote: lol, i know this is different from the topic right?. lol


*shrugs* No worries.
User avatar
biostudent84
Site Admin
Site Admin
 
Posts: 977
Joined: Thu Nov 11, 2004 6:00 am
Location: Farmville, VA

Postby b_d_41501 on Mon Jun 13, 2005 7:43 pm

lol. I'm not very good at the whole programming thing. :lol:
"Take four red capsules, in ten minutes take two more. Help is on the way."
----- Voice from the Medicine Cabinet
User avatar
b_d_41501
King Cobra
King Cobra
 
Posts: 746
Joined: Mon Apr 25, 2005 9:55 pm
Location: Kentucky

Postby biostudent84 on Mon Jun 13, 2005 8:14 pm

b_d_41501 wrote:lol. I'm not very good at the whole programming thing. :lol:


Me neither. But if you want to go into pure biology, not medicine, you really need to learn a little programming. It is becoming more and more needed in the biological world. Especially with the advent of bioinformatics.
User avatar
biostudent84
Site Admin
Site Admin
 
Posts: 977
Joined: Thu Nov 11, 2004 6:00 am
Location: Farmville, VA

Next

Return to Bioinformatics

Who is online

Users browsing this forum: No registered users and 0 guests