Biology-Online • View topic - mRNA codon and amino acid

Join for Free!
122128 members

mRNA codon and amino acid

Genetics as it applies to evolution, molecular biology, and medical aspects.

Moderator: BioTeam

mRNA codon and amino acid

Postby victor » Thu May 26, 2005 1:24 pm

What is the best way to know what amino-acid that is replicated by mRNA codon?
ex: what is the best way to know that AUG codon produces Metionin? (if I'm not mistaken). Does it means that I have to remember all the 64 triplets of synonymus codon in my biology dictionary?
User avatar
King Cobra
King Cobra
Posts: 2668
Joined: Sat Apr 30, 2005 12:01 pm
Location: Yogyakarta, Indonesia..

Postby canalon » Thu May 26, 2005 1:33 pm

As far as I know yes. Of course there is this 3 entry table that helps remembreing some synonymous codons, but there is no logical shorcut for it.
But what's the point? The only one you really need to know are start and stop codons. For the othr, well, you've got you book :wink:

User avatar
Inland Taipan
Inland Taipan
Posts: 3909
Joined: Thu Feb 03, 2005 2:46 pm
Location: Canada


Postby victor » Thu May 26, 2005 1:52 pm

As far as I've read my bio book...Actually you can determine what is the amino-acids from their characteristics...example like you can determine some amino-acids by seeing the last nitrogenic bases at the codon (pyrimidine or purine). From there you'll only know whether the amino-acids are hydrofobic or specific name in it... :(
User avatar
King Cobra
King Cobra
Posts: 2668
Joined: Sat Apr 30, 2005 12:01 pm
Location: Yogyakarta, Indonesia..

Postby MrMistery » Thu May 26, 2005 8:06 pm

All nice and dandy. Until you get the olympics and you get a question like "What protein sequence will you get from the following DNA generative cathene- ATGCCAGTCAGTAACGTAGCAGATACAGATACAGGGATGACCCAGTAGATGAGAGATGCACAGCATGACTGAC" And then you will wish you will have studied that table
"As a biologist, I firmly believe that when you're dead, you're dead. Except for what you live behind in history. That's the only afterlife" - J. Craig Venter
User avatar
Inland Taipan
Inland Taipan
Posts: 6832
Joined: Thu Mar 03, 2005 10:18 pm
Location: Romania(small and unimportant country)

Postby biostudent84 » Thu May 26, 2005 8:23 pm

We had to do this for exams in genetics. But we were always given a copy of the genetic code. You aren't allowed to use one?

User avatar
Site Admin
Site Admin
Posts: 974
Joined: Thu Nov 11, 2004 6:00 am
Location: Farmville, VA

Postby MrMistery » Thu May 26, 2005 8:27 pm

No we aren't. We have to memorise it. If you have a copy of the genetic code that question can be solved easly. Remembering the code is a major pain!
"As a biologist, I firmly believe that when you're dead, you're dead. Except for what you live behind in history. That's the only afterlife" - J. Craig Venter
User avatar
Inland Taipan
Inland Taipan
Posts: 6832
Joined: Thu Mar 03, 2005 10:18 pm
Location: Romania(small and unimportant country)

Postby canalon » Thu May 26, 2005 8:43 pm

MrMistery wrote:No we aren't. We have to memorise it. If you have a copy of the genetic code that question can be solved easly. Remembering the code is a major pain!

That is really pointless. Nobody need to know that. This is just filling your mind with useless data. Ridiculous. Asthe saying goes in France "une tete bien faite est meilleure qu'une tete bien pleine" (A well organized mind is better than a full memory). You got books for this.
User avatar
Inland Taipan
Inland Taipan
Posts: 3909
Joined: Thu Feb 03, 2005 2:46 pm
Location: Canada

Postby mith » Fri May 27, 2005 4:42 am

That's an awesome quote!
Living one day at a time;
Enjoying one moment at a time;
Accepting hardships as the pathway to peace;
User avatar
Inland Taipan
Inland Taipan
Posts: 5345
Joined: Thu Jan 20, 2005 8:14 pm
Location: Nashville, TN

Postby MrMistery » Fri May 27, 2005 6:12 pm

You are right Patrick. It is useless. But you have to realise one thing: practically my only chance of getting out of this damned country and to study in a prestiogious university in th US is having at least a bronze medal at IBO. But in order to qualify for Nationals i had to memorise the genetic code. If that is the stupid junk i need to do in order to acomplisg my dream, than so be it!
"As a biologist, I firmly believe that when you're dead, you're dead. Except for what you live behind in history. That's the only afterlife" - J. Craig Venter
User avatar
Inland Taipan
Inland Taipan
Posts: 6832
Joined: Thu Mar 03, 2005 10:18 pm
Location: Romania(small and unimportant country)

Postby canalon » Fri May 27, 2005 6:48 pm

I do not say that you are stupid to do it, I say that whoever came with this kind of question is stupid. Science has nothing to do with this kind of things. A good scientist is not someone who knows a lot (no human can know enough know) but someone who is able to use his knoledge to search for the relevant dat when they are needed. Internet and Library are here to contain the data, brains can be better used as cross referencing them and devising and analyzing results.

But good luck for the IBO, i wish you can get out of Romania, if it is what suits you. But Why prestigious university in the US? Europe also has some great university, which are also usually much cheaper.

User avatar
Inland Taipan
Inland Taipan
Posts: 3909
Joined: Thu Feb 03, 2005 2:46 pm
Location: Canada

Return to Genetics

Who is online

Users browsing this forum: No registered users and 1 guest