Programming Language of Choice

[cytochromeP]

Which is the programming language of choice for doing Bio-informatics research ?

[mith]

Perl and java can be used online, dunno about the others though.

[Chris4]

Does anyone here use programming in biology?
I want to get started with a language but im pretty much a beginner when it comes to programming. So I need something fairly easy. I am fairly confident with computers and this will just be a hobby. for now.
I am looking at python as i used it at a workshop i went to and i know its used a lot in biology.
I initially want to use for it for Systems Biology. Creating models of pathways and systems. And then making predictions about the pathway etc.

[cytochromeP]

#!/usr/bin/perl

$dnaseq='ggggaccccattggggcccc';

$counter=0;

while($dnaseq=~/a/g){
$counter++;
}

print 'adenine: '.$counter*100/length($dnaseq).' %';

#the above code wud print the % of adenine in the given DNA sequence
#to run the programme save the code in a file 'dnaseq.pl'
#and execute it by the command
# perl dnaseq.pl

[ac83]

I'm doing a bioinformatics degree in uni right now. It doesn't seem like there's really anyone out there with the training that knows what is going on truly with both the computer side and the bio side.

[cyberpostdoc]

Perl > java > c/c++

JSP PHP

MySQL oracle

[Chris4]

I'm doing a bioinformatics degree in uni right now. It doesn't seem like there's really anyone out there with the training that knows what is going on truly with both the computer side and the bio side.

lol. Thats true. Same with systems biology. Should be a problem really, but im not sure it is at the moment. As long as it works.

[biostudent84]

Perl > java > c/c++

EEEEEK! A linux zealot! Kill it! Kill it!!!!!!!!!!

hahahahaha

[b_d_41501]

I program with Visual Basic 6.0. lol, i know this is different from the topic right?. lol

[biostudent84]

lol, i know this is different from the topic right?. lol

*shrugs* No worries.

[b_d_41501]

lol. I'm not very good at the whole programming thing.

[biostudent84]

lol. I'm not very good at the whole programming thing.

Me neither. But if you want to go into pure biology, not medicine, you really need to learn a little programming. It is becoming more and more needed in the biological world. Especially with the advent of bioinformatics.