
Join for Free!
121193 members

How do I create the sequence contig of this DNA?

Genetics as it applies to evolution, molecular biology, and medical aspects.

Moderator: BioTeam

How do I create the sequence contig of this DNA?

Postby TToe » Tue Nov 20, 2012 1:41 pm

You have the following sequence reads from the protein-encoding region of a Homo sapiens cDNA clone:

Read 1: tattatcctgactttagccatgaatatcatgagtacattgcagtgggctgttaactccagcataga
Read 2: caaccaaaccatacaagaatggccaactctcgaaagttatgattattgagaattcacacgtg
Read 3: agttatgattattgagaattcacacgtgaagaaagatgacatctggccctcagggggtcaaa
Read 4: ggctgttaactccagcatagatgtggatagcttgatgcgatctgtgagccgagtctttaagttcattgaca
Read 5: gaagaaagatgacatctggccctcagggggtcaaatgactgtcaaagatctcaca
Read 6: tctttaagttcattgacatgccaacagaaggtaaacctaccaagtcaaccaaaccatacaagaatggc
Read 7: atttccattttaacaacaggagaaggagaaggaagagttggtattatcctgactttagccatgaa

c. Use these 7 sequence reads to create a sequence contig of this portion of the H. sapiens cDNA. Show clearly how you achieved this.

I don't understand what's going on, help me to understand what this DNA sequence is supposed to tell me and how I sequence contig?

After this I have to convert it to possible reading frames.
Posts: 20
Joined: Tue Nov 20, 2012 1:37 pm

Re: How do I create the sequence contig of this DNA?

Postby wbla3335 » Tue Nov 20, 2012 7:14 pm

Look for overlapping sequences. For example, Read 1 begins with tattat. Does this sequence occur in any of the other reads?
Posts: 227
Joined: Thu Aug 17, 2006 7:20 am

Postby JackBean » Wed Nov 21, 2012 6:11 pm

you have to do basically multiple alignment

Cis or trans? That's what matters.
User avatar
Inland Taipan
Inland Taipan
Posts: 5694
Joined: Mon Sep 14, 2009 7:12 pm

Return to Genetics

Who is online

Users browsing this forum: No registered users and 1 guest