How do I create the sequence contig of this DNA?

[TToe]

You have the following sequence reads from the protein-encoding region of a Homo sapiens cDNA clone:


Read 1: tattatcctgactttagccatgaatatcatgagtacattgcagtgggctgttaactccagcataga
Read 2: caaccaaaccatacaagaatggccaactctcgaaagttatgattattgagaattcacacgtg
Read 3: agttatgattattgagaattcacacgtgaagaaagatgacatctggccctcagggggtcaaa
Read 4: ggctgttaactccagcatagatgtggatagcttgatgcgatctgtgagccgagtctttaagttcattgaca
Read 5: gaagaaagatgacatctggccctcagggggtcaaatgactgtcaaagatctcaca
Read 6: tctttaagttcattgacatgccaacagaaggtaaacctaccaagtcaaccaaaccatacaagaatggc
Read 7: atttccattttaacaacaggagaaggagaaggaagagttggtattatcctgactttagccatgaa


c. Use these 7 sequence reads to create a sequence contig of this portion of the H. sapiens cDNA. Show clearly how you achieved this.

I don't understand what's going on, help me to understand what this DNA sequence is supposed to tell me and how I sequence contig?

After this I have to convert it to possible reading frames.

[wbla3335]

Look for overlapping sequences. For example, Read 1 begins with tattat. Does this sequence occur in any of the other reads?

[JackBean]

you have to do basically multiple alignment