Login

Join for Free!
66395 members


fusion PCR

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderator: BioTeam

Re:

Postby jackliu » Tue Apr 20, 2010 11:54 am

JackBean wrote:KOD Plus, that seems fine. I guess you can't try you primer pair with some positive control, can you? How many steps in cycling are you using?

Thank you for reminding me to try my primers. I have tried them and find that they don't work in my PCR system even degrade the Tm to 50 Celsius(no pieces in positive control ; smear in my fusion sample ). I'm examining my template as well though it worked well in amplifing a 3k fragment.
One-step and Two-step were used but no result was achieved. Upset... :(
jackliu
Garter
Garter
 
Posts: 3
Joined: Wed Apr 14, 2010 2:10 am

Re: fusion PCR

Postby Sorange » Mon May 10, 2010 5:37 pm

I've tried overlap PCR for months, however, yet to success. I'd like to fusion 3 fragments, 2.2+0.7+0.8. I fused the first two (3K, and it successed), and added 0.8 later. By using phusion polymerase, a band near 4K appeared(not quiet sharp but repeatable). After doing gel extraction, I failed to produce the 3.8K product by using it as DNA template with neither the ended primer pairs nor the nested primer pairs(should be 3.5K). I also used this gel extraction product to clone by TOPO blunt end kit, but only fragments (2.2, 0.7, 0.8 )were screened. is it possible that my 3.8K product is unstable and break into original pieces after gel extraction? or the large ends of full length product were missing and this could lead to the failure of nested PCR? PLEASE give me some advices or suggestions, it would a great help for me. Thanks!
Sorange
Garter
Garter
 
Posts: 2
Joined: Mon May 10, 2010 5:05 pm

Postby JackBean » Mon May 10, 2010 7:02 pm

did you run the gel properly? Did you separate the bands? I see it in wrong gel extraction, as I don't see any reason, why should it break into your original pieces. Now they are just one piece ;)
http://www.biolib.cz/en/main/

Cis or trans? That's what matters.
User avatar
JackBean
Inland Taipan
Inland Taipan
 
Posts: 5359
Joined: Mon Sep 14, 2009 7:12 pm

Postby Sorange » Tue May 18, 2010 7:33 am

thank you, JackBean. Although I'm confident with this gel extraction part, I'll try it again later! BTW, do you ever see any unstable situation at the end of the overlapping product? I mean could it be possible that strong exonucleusae activity may degrade the product?
Sorange
Garter
Garter
 
Posts: 2
Joined: Mon May 10, 2010 5:05 pm


Re: fusion PCR

Postby bengen » Tue Jun 08, 2010 12:25 pm

Hey!

I also got a big problem with fusion PCR, already posted here, because i saw this topic too late.
about18892.html

Well, i want to fuse 2 Fragments, one with 1,1 kb, and a second with 1,3 kb. So I amplify the original fragments with Phusion-Polymerase, and got a good yield.
Then purification of the product, and starting to fuse them.

The overlapping primers are:
First fragment 3'
CATATCCGTCGACGCATTGAATATTTTATTCCCATTTGTACCCAA

Second fragment 5'
AATATTCAATGCGTCGACGGATATG

Bold is the overlapping region.

Now i tried many combinations with Taq, Phusion, and Pfu Polymerase. Different annealing temps from 52-59 degrees celcius. With a lof of template, with less template. Don't know what to do, really need a good advise :).

Thank you very much,
Ben
bengen
Garter
Garter
 
Posts: 2
Joined: Sun Jun 06, 2010 4:33 pm

Re: fusion PCR

Postby rubyarch » Tue Aug 03, 2010 1:30 am

In reply to Bengen:
Wondering if you've had any success yet. I'm also trying to anneal and amplify a 1.9 kb and 0.8 kb which have about 30bp of overlap. I've also tried PfuUltra and DreamTaq polymerases using from 30ng up to 110ng of each template product (the 1.9 and 0.8 kb fragments), while keeping my end primers at 1uM. Hope you've had a breakthrough :D and if so, what worked?
If I get mine to work, I'll post... Thanx!
rubyarch
Garter
Garter
 
Posts: 1
Joined: Tue Aug 03, 2010 1:18 am

Re: fusion PCR

Postby Falko » Tue Aug 30, 2011 6:38 am

you can do a simple PCR including the intron. The cells should splice it as normal.
Falko
Garter
Garter
 
Posts: 4
Joined: Thu Aug 11, 2011 12:49 pm

Re: fusion PCR

Postby JackBean » Tue Aug 30, 2011 7:03 am

Falko wrote:you can do a simple PCR including the intron. The cells should splice it as normal.

depends what cells. E.g. bacteria won't splice it at all, since they don't have any splicing machinery and even if you put it into other eukaryotic organism, it may splice it differently.
http://www.biolib.cz/en/main/

Cis or trans? That's what matters.
User avatar
JackBean
Inland Taipan
Inland Taipan
 
Posts: 5359
Joined: Mon Sep 14, 2009 7:12 pm

Re: fusion PCR

Postby qjiang » Sat Oct 22, 2011 2:15 am

Hi,Sorange .I have the same problem like you.I want to fusion two flagments with the size of 0.8 and 2.9Kb.the overlapping size is 24bp,Tm 54C,Phusion enzyme.I successfully get the 0.8 and 2.9Kb fragments,but it dose not work when do fusion pcr.I wonder whether you have solve this problem later.I would appreciated it if someone can give me some advice .Thanks!
qjiang
Garter
Garter
 
Posts: 1
Joined: Wed Oct 19, 2011 4:08 am

Previous

Return to Molecular Biology

Who is online

Users browsing this forum: No registered users and 0 guests