Biology-Online • View topic - qPCR primer design - possible off-target

Join for Free!
122248 members

qPCR primer design - possible off-target

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderator: BioTeam

qPCR primer design - possible off-target

Postby PDavidsen » Sat Apr 30, 2011 2:28 pm

Hi all,

I'm designing primers for SYBRGreen-based qPCR (using the software Primer3).
I've tried to check the specificity of the primers by blasting them. However, one of the potential off-targets given by Primer-BLAST is:

Code: Select all
product length = 196
Forward primer  1     AAGCAGAAAACCAGCAGCTC  20
Template        3134  C..G..C.C.G.........  3153

Forward primer  1     AAGCAGAAAACCAGCAGCTC  20
Template        3329  C......C.C.AG.......  3310

Anyone how would like to share their thoughts on this potential "forward-forward" problem.

NB. The annealing temperature will be 60 C

Kind regards
Last edited by PDavidsen on Sat Apr 30, 2011 9:10 pm, edited 2 times in total.
Posts: 3
Joined: Mon Apr 04, 2011 4:46 pm

Postby JackBean » Sat Apr 30, 2011 7:46 pm

does that mean, that it binds with five residues with such big gaps? I wouldn't care about that.

Cis or trans? That's what matters.
User avatar
Inland Taipan
Inland Taipan
Posts: 5694
Joined: Mon Sep 14, 2009 7:12 pm

Postby PDavidsen » Sat Apr 30, 2011 8:23 pm

No, the dots mean perfect complementarity between primer and template. So the forward primer will/might anneal with 5 mismatches two places on the same template (196 bp between the two binding sites)
Posts: 3
Joined: Mon Apr 04, 2011 4:46 pm

Postby JackBean » Sun May 01, 2011 9:10 am

I see now :roll:

Yes, there is posibility, that you could get some amplicon. You could try more stringent conditions or some probe for your gene

Cis or trans? That's what matters.
User avatar
Inland Taipan
Inland Taipan
Posts: 5694
Joined: Mon Sep 14, 2009 7:12 pm

Postby canalon » Mon May 02, 2011 2:21 pm

It should still work, but that will decrease your PCR efficiency, and if you are working with multiple strains/subjects, the effect will vary and not be competely correlate with your control. So I would avoid that particular combination if at all possible.

Science has proof without any certainty. Creationists have certainty without
any proof. (Ashley Montague)
User avatar
Inland Taipan
Inland Taipan
Posts: 3909
Joined: Thu Feb 03, 2005 2:46 pm
Location: Canada

Return to Molecular Biology

Who is online

Users browsing this forum: No registered users and 3 guests