
Join for Free!
118822 members

HELP! translate the piece of mRNA

Genetics as it applies to evolution, molecular biology, and medical aspects.

Moderator: BioTeam

HELP! translate the piece of mRNA

Postby ola80 » Wed Dec 01, 2010 2:27 pm

Please help me with this question, How does it work?
Translate the following piece of mRNA

describe the effect of changing the second base in the third codon from a C to a U.
What effect might this have on the protein?
Posts: 2
Joined: Wed Dec 01, 2010 2:19 pm

Re: HELP! translate the piece of mRNA

Postby JackBean » Wed Dec 01, 2010 3:01 pm



now, divide the triplets: CGA AUG CCA GCA GGC UCC CCU CAU

asign amino acid to each triplet up to any STOP codon in frame. Choose any table you like from the pictures http://lmgtfy.com/?q=genetic+code

now, the third codon is CGA AUG CCA GCA GGC UCC CCU CAU so just change the C to U and look, whether it changes the amino acid coded.

that's all ;)

Cis or trans? That's what matters.
User avatar
Inland Taipan
Inland Taipan
Posts: 5689
Joined: Mon Sep 14, 2009 7:12 pm

Re: HELP! translate the piece of mRNA

Postby ola80 » Wed Dec 01, 2010 4:23 pm

thanks! but why GCA is the third codon? it looks like fourth, but i start to count from the start codone, I mean AUG ? and in this sequence :
CGAAUGCCAGCAGGCUCCCCUCAU i was looking for the stop codon but there's no STOP codon, am i right? - STOP codon are: UAA,UAG,UGA
Posts: 2
Joined: Wed Dec 01, 2010 2:19 pm

Postby JackBean » Thu Dec 02, 2010 2:16 pm

start calculating from the START codon ;)

Yes, you're rigth, there's no STOP codon...

Cis or trans? That's what matters.
User avatar
Inland Taipan
Inland Taipan
Posts: 5689
Joined: Mon Sep 14, 2009 7:12 pm

Return to Genetics

Who is online

Users browsing this forum: No registered users and 0 guests