Login

|
|
DNA TranscriptionModerator: BioTeam
5 posts • Page 1 of 1
DNA TranscriptionI was wondering if someone could help me answer the following questions. If there is a charge, how much? and how would I pay? Thank you.
Here are the questions: The following DNA sequence is found in a segment of double-stranded DNA that encodes for the English word describing protein that is found throughout your body: AAGATTAGTAGTACGACAATC Is this the informational or template sequence? How could you tell? What does your conclusion mean in terms of determining the name of the protein? What is the name of the protein? How did you determine the sequence that decoded to give you this answer? And Question 2 is: This is an mRNA sequence for the name of a protein found throughout your body: 5' A AG G G U G U A G A A G C U A A G G G U 3' What is the informational DNA sequence that encodes for the word for this protein? Be sure to note the 5' and 3' ends. What is the antisense DNA sequence that would be found in the template strand for the information sequence that you submitted as an answer for the previous question? Be sure to note the 5' and 3' ends. What is the protein? Explain how, in your answers to questions 3a and 3b, you obtained the sequences listed from the RNA sequence. Please Help!!
There is no charge, but our policy is not to answer homework questions. If you show you actually tried to answer and were unable to, one of our users might help.
"As a biologist, I firmly believe that when you're dead, you're dead. Except for what you live behind in history. That's the only afterlife" - J. Craig Venter
Warning: Spoiler!
q1: You go here http://www.vivo.colostate.edu/molkit/tr ... index.html and find that first direct ORF 5'-AAGATTAGTAGTACGACAATC-3' gives you KISS Thus, you conclude that the protein is most probably hemoglobin which is found in all tissues and kisses them gently! The same for q2
Re: DNA Transcriptionhye...im new user here
well for the first question....both strand can be the templates....i think for this case...it is a template then use the genetic code to know the protein...u must noe the codon..snd snticodon because trna will brings the protein
If we answer your questions how will you learn? Read your biology book I suggest. Its what we all did.
5 posts • Page 1 of 1
Who is onlineUsers browsing this forum: No registered users and 0 guests |
© Biology-Online.org. All Rights Reserved. Register | Login | About Us | Contact Us | Link to Us | Disclaimer & Privacy