Login

|
|
Transcription & TranslationModerator: BioTeam
2 posts • Page 1 of 1
Transcription & TranslationHi, I'm reading on some concepts involving protein synthesis. I was doing some practice problems from my biology book which involves transcription and translation. I was wondering if anyone here may please check over my work. Thank You.
Question: Suppoe you have the following original strand of DNA (5' is on the left and 3' on the right)
(i) What is the nucleotide on the 5' end of the template strand? a) AAAAAA b) TTTTTT c) ATAAAA d) TATTTT e) UUUUUU This just means writing down the complementary base pairs to get the template strand so:
Looking at the 5' end of the tmplate strand, we have d) TATTTT (ii) What is the sequence on the 5' end of the normal mRNA? a) AAAAAA b) TTTTTT c) AUAAAA d) UUUUUU Do I look for the "TATA box" on the template strand and then the first 6 bases would be the sequence on the 5' end of the mRNA? so c) AUAAAA (iii) What is the sequence of the mRNA for the normal gene? a) AAAAAAAUGGGCCCGGGAGCAUAAAUGAAUUUUUUUUUAAAAUAAAA b) AUGGGCCCGGGAGCAUAAAAUGAAUUUUUUUUUAAAAUAAAA c) AUGGGCCCGGGAGCAUAA d) AAAAAAATGGGCCCGGGAGCATAAAATGAATTTTTTTTTAAAATAAAA The answer to this should be the original coding strand but with the thymine replaced with uracil, correct? so a) (iv) What is the first anticodon that will appear at the ribosome for the normal gene? a) AUG b) AAA c) UAC d) UUU Well the first start codon is usually AUG, so the anticodon should be UAC, so c) UAC? I would greatly appreciate it if anyone could please help me with these. Thank you.
2 posts • Page 1 of 1
Who is onlineUsers browsing this forum: No registered users and 2 guests |
© Biology-Online.org. All Rights Reserved. Register | Login | About Us | Contact Us | Link to Us | Disclaimer & Privacy