Biology-Online • View topic - DNA sequence, Nucleotide sequence - Sequence of 3870 nuc.
Login

Join for Free!
122456 members
Advertisement
Advertisement

DNA sequence, Nucleotide sequence - Sequence of 3870 nuc.

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderator: BioTeam

DNA sequence, Nucleotide sequence - Sequence of 3870 nuc.

Postby SystemRGB » Wed Sep 23, 2015 12:10 am

Image

Visualization of DNA sequence invented in 2015 by Polish scientist Gregory Podgorniak, above sequence of 3870 nucleotides -

ATCCTTGTTATTGCAGTAGCTCAGTACTTGCACGTGATGGGGCGCGTACACTGGAGACACGTCTTGATATTTAA ACCTTGCTCCAGCCCGGCTACAGCAGAAGACCGCAACAGTCGTGCTGACCAGTTAGAAAGATGATATGTGCGCA GCTTTTAACAGGGTGCCCCGTGGAACAGTCCTGTCGACTACAAAGGATGCGTTATCAGTCCCACCATCTCAGCG TGTTCGCCCATTACTAAGCTACACGGCGCAATAGCGGGGGACGCGCCGCCCCCCGATAACGATCATGTTGGGTA GGGACAGTCACAACGGTCTCCTGTTTACTAACAATTCATGTCAACACGCCATCTTACATGGTGTGACTGTCTAA GGGGCGGGCGGTTTCCTACAACTCCGAAGTAATTCCCTCTGTCAGTATCACAGATGCCAAAGAATTCTATCTGA ACCAGCACAGCTAAAATACATGCTCCGTAGGCCACTTTCGCAAATCCAAATGCGATAATTTATCTTAAGACTGC ATCTGCAAACCCAGGCCCGGGGTGATAGCTCTCATCTGAATATAACGTGTGCCAAAGCGCGTGGCCGAGCTCAT TTCAAGCCAACATTCGCATGTCGTGGAAGTTCGTCACCAGGCCATAGATACTTACATAAGCCGGAAAGTACACC ATCAGGCGAGCTAGTCATCACGGTTACTGGGGATTCATGCGTGGCGACTGTTCCAAAAGTTGCCATACGGCAGG ACCTTTTATTTTCTGGTACAGACGTCACCGCAATCTTCTAACTACTAACGGCGCTAAAACTCTGCGCAAGTCAG TTGGGTCTTTCTATGATATAACATGTCGTAACTGACATTAAGAGTTGCGCGTATAACTGCGAATAGACTGCATA GCTCGTCCTAGAACTATCATGGTGTACGGCATCGCTCTGACACTTATTATTCTTGGCTCTGGCTTAATATCCCC GTCGATCCCAGCGTCTCCAAGTCGTACTTCCGTGGTTGTCATCTCATTCCCAGAGTGCGGGTCAGCGAATATCT TACGTACCCCTGCCGAAGTCGTACCCCCGAGCTTCGGTATCTCATATAGTGTCGGCGGCACGACTGGGCTCGGG AGCTCGGAAGTTGGATAAATCATATGTGACGAGTCCAGAAAGTTCAGTATAGCCTTGGTGTTTCCAATGGTTCT CATGTCGTGGCCGAAGTCGAGCTCCTCTTAGCCCGCAGGAACAAACGAGGGCTACGTACAGGGTTGTCAGTGTA ATTAAAGTATCGCCGAGACTCTAGTCGGCAGAGAAACCAGTTGGCCTGTTCCCTTCTCTACCCGACCCTCTTAC TTGTGATAATATGTACAAATTACCCGGAAAATAGAGTCGCAAATCAGACGGCAGAAGTCGTAGTATCAGTTTAT TTATTTTATCATTGACTCTGGCCGTAGTACTTTTTCGTCGGTTACCCCCTGCTGATCCTGAAACGAACCCACAC GAAAGTTCTAGCGAAACAGCGGATCTGCGCCCCGTTTTGGGTACGGTGTAATTGTACGCCTGAACTGATACGGC ACAGGTCGGTTCAATCCGTTTCCCCGGATCTCACGTCATAGGACCTATGAGTAGGTAGGTCTTAAAAGATAATG ATTCTGAGGGCTATCACAGCATAATTATTTGTTACAGACGACATTCTCATATTTTCCTGCTTTGCAGGAAAGAG TATTGAACCGCTGAGGAATTACCCACGTGTTGCCAGGCAAGAGACGGCCAGGAATCGCCACGGATTGGGCACAT GACGTCGCGGACAACCCAGAATTGTCTTGAGCGATGGTAAGATCTAACCTCACTGCCGGGGGAGGCTCATACCT GGGGCTTTACTGATGTCATACCGTCTTGCACGGGGATAGAATGACGGTGCCCGTGTCTGCTTGCCTCGAAGCAA TTTTCTGAAAGTTACAGACTTCGATTAAAAAGATCGGACTGCGCGTGGGCCCGGAGAGACATGCGTGGTAGTCA TTTTTCGACGTGTCAAGGACTCAAGGGAATAGTTTGGCGGGAGCGTTACAGCTTCAATTCCCAAAGGTCGCAAG ACGATAAAATTCAACTACTGGTTTCGGCCTAATAGGTCACGTTTTATGTGAAATAGAGGGGAACCGGCTCCCAA ATCCCTGGGTGTTCTATGATAAGTCCTGCTTTATAACACGGGGCGGTTAGGTTAAATGACTCTTCTATCTTATG GTGATCCAAGCGCCCGCTAATTCTGTTCTGTTAATGTTCATACCAATACTCACATCACATTAGATCAAAGGATC CCCGAGCCCAGTCGCAAGGGTCTGCTGCTGTTGTCGACGCCTCATGTTACTCCTGGAATCTACCTGCCCTCCCC TCACCGGTTAAGGCGTGTGATCGACGATGCAGGTATACATCGGCTCGGACCTACAGTGGTCGATCGACTGGCTA CTGGCTTCGCGGTTCGGCGCGTAGTTGAGTGCGATAACCCAACCGGTGGCAAGTAGCAAGAAGACCTACCTGGG TCACCTTAGACAACCTAACTAATAGTCTCTAACGGGGAATTACCTTTACCAGTCTCATGCCTCCAATATATCTG CACCGCTTCAATGATATCGCCCACAGAAAGTAGGGTCTCAGGTATCGCATACGCCGCGCCCGGGTCCCAGCTAC GCTCAGGACGACAGTAGAGAGCTATTGTGTAATTCAGGCTCAGCATTCATCGACCTTTCCTGTTGTGAATATTG TGCTAATGCATCTCGTCCGTAACGATCTGGGGGGCAAAACCGAATATCCGTATTCTCGTCCTACGGGTCCACAA TGAGAAAGTCCTGCGCGTGATCGTCAGTTAAGTTAAATTAATTCAGGCTACGGTAAACTTGTAGTGAGCTAAGA ATCACGGGAATCACGGGTTCGCTACAGATGAACTGAATTTATACACGGACAACTCATCGCCCATTTGGGCGTGG GCACCGCAGATCAAAAGTGGCAGATTAGGAGTGCTTGATCAGGTTAGCAGGTGGACTGTATCCAACAGCGCATC AAACTTCAATAAATCCAAAGCGTTGTAGTGGTCTAAGCACCCCTGAACAGTGGCGCCCATCGTTAGCGTAGTAC AACCCTTCCCCCTTGAGGTGCGACATGGGGCCAGTTAGCCTGCCCTATATCCCTTGCACACGTTCAATAAGAGG GGCTCTACAGCGCCGCTTTTTAAATTAGGATGCCGACCCCATCATTGGTAACTGTATGTTCATAGATATTTCTT CAGGAGTAATAGCGACAAGCTGACACGCAAGGGTCAACAATAATTTCTACTATCACCCCGCTGAACGACTGTCT TTGCAAGAACCAACTGGGCTTAGATTCGCGTCCTAACGTAGTGAGGGCCGAGTCATATCATAGATCAGGCATGA GAAACCGACGTCGAGTCTACACACGAGTTGTAAACAACTTGATTGCTATACTGTAGCTACCGCAAGGATCTCCT ACATCAAAGACTACTGGGCGATCTGGATCCGAGTCAGAAATACGAGTTAATGCAAATTTACGTAGACCGGTGAA AACACGTGCCATGGGTTGCGTAGACCGTAGTCAGAAGTGTGGCGCGCTATTCGTACCGAACCGGTGGAGTATAC AGAATTGCTCTTCTACGACGTAAGGAGCTCGGTCCCCAATGCACGCCAAAAAAGGAATAAAGTATTCAAACTGC GCATGGTCCCTCCGCCGGTGGCACTATTATCCATCCGAACGTTGAACCTACTTCCTCGGCTTATGCTGTCCTCA ACAGTATCGCTTATGAATCGCATGCGGCTGTGGATCTTAACGGCCACATTCTTAATTCCGACCGATCACCGATC
GCCTTTCCTCGCTGGTACAATG

see site V - DNA, nucleotide sequence, numeral system http://studia.scienceontheweb.net/visualization.php
SystemRGB
Garter
Garter
 
Posts: 12
Joined: Fri Nov 14, 2014 11:33 pm

Re: DNA sequence, Nucleotide sequence - Sequence of 3870 nuc

Postby SystemRGB » Wed Sep 23, 2015 2:38 am

whole sequence:

Image
SystemRGB
Garter
Garter
 
Posts: 12
Joined: Fri Nov 14, 2014 11:33 pm

Re: DNA sequence, Nucleotide sequence - Sequence of 3870 nuc

Postby SystemRGB » Wed Oct 07, 2015 12:26 pm

This type of sequence can be a recording of complete genome of ssDNA (single stranded DNA) virus. For example Porcine circovirus-1 from the genus Circovirus has a single-chain genome of 1759 nucleotides long.
SystemRGB
Garter
Garter
 
Posts: 12
Joined: Fri Nov 14, 2014 11:33 pm



Return to Molecular Biology

Who is online

Users browsing this forum: No registered users and 1 guest