Login

Join for Free!
118478 members


Annealing Temparature

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderator: BioTeam

Annealing Temparature

Postby Helics » Tue Feb 18, 2014 10:49 am

My Gene of Interest is 2kb long
Primer-F : GCTCTAGAGTGATAGTAGGCATGG
Primer-R : GCGATATCCTACACCCAAGCTGC


I used the following program:

94C 1min
94C 2min
56C 1min
72C 2min

final elongation 72C 7min

I'm failed to amplify my gene of interest. please help me. :( :( :( :( :(
Helics
Garter
Garter
 
Posts: 38
Joined: Fri Oct 12, 2012 9:10 am

Postby JackBean » Tue Feb 18, 2014 12:40 pm

First, you seem to have big difference in the Tms, second the Tms seem to be quite high (62 - 69°C).

Are you sure your denaturation in the beginning is only 1 min or is it a typo? Why do you have such long denaturation during cycling? Why do you have such long annealing? What polymerase do you use? What is the GC content of your GOI? How many cycles did you have? What is the template? What concentration did you use?
http://www.biolib.cz/en/main/

Cis or trans? That's what matters.
User avatar
JackBean
Inland Taipan
Inland Taipan
 
Posts: 5678
Joined: Mon Sep 14, 2009 7:12 pm

Postby Cat » Fri Feb 21, 2014 1:14 am

According to NCBI this pair should not amplify anything anyway...
Cat
King Cobra
King Cobra
 
Posts: 631
Joined: Thu Feb 14, 2008 7:40 pm


Postby vladCH » Sat Feb 22, 2014 7:54 pm

The primers obviously contain added restriction sites and the matching part is quite short. I would anneal the first cycle at 50°C and the rest at 65°C. Denaturation for 10s will be enough, but a bit higher temperature 95-98°C might be better. Elongation depends on polymerase, so 1 min can be enough for Phusion, but 4 min will be required for Pfu.
vladCH
Garter
Garter
 
Posts: 2
Joined: Sat Feb 22, 2014 7:31 pm

Re: Annealing Temparature

Postby Helics » Sun Feb 23, 2014 4:59 pm

Primer_F: 5'-GCTCTAGAGTGATAGTGAGCATGG-3'

Primer_R: 5'-GCGATATCCTACACCCAAGCTGC-3'


CORRECTED PRIMER SEQUENCE.

THANKS ALL.
I WILL TRY SUGGESTED EXP. CONDITION.

THANKS "vladCH".
Helics
Garter
Garter
 
Posts: 38
Joined: Fri Oct 12, 2012 9:10 am


Return to Molecular Biology

Who is online

Users browsing this forum: No registered users and 1 guest

cron