Login

Join for Free!
119222 members


Population Genetics Questions

Genetics as it applies to evolution, molecular biology, and medical aspects.

Moderator: BioTeam

Population Genetics Questions

Postby animus31 » Wed Nov 21, 2012 3:36 pm

Here are 4 questions for which I would love some guidance. Thanks in advance.

1. You obtain the following sequences from different genomic clones from one region of the human genome. In the space below the sequences, align the sequences to make a single sequence contig, showing how the sequences overlap. (To make things fit, you may need to write small or wrap around!) NOTE: All six sequences read in a 5’ to 3’ direction. Five of the six sequences are from the same strand, but one is from the opposite strand so you will need to figure out which one it is and use its reverse complementary strand.

Sequence 1: AACAAAAATGTTGTTATTTTTATTTCAGATG
Sequence 2: TGTCTGCCATTCTTAAAAACAAAAATGT
Sequence 3: ATGCGATCTGTGAGCCGAGTCTTTA
Sequence 4: AATAACAACATTTTTGTTTTTAAGA
Sequence 5: TGTTATTTTTATTTCAGATGCGA
Sequence 6: TTCAGATGCGATCTGTGAGCCGAG









Four maize populations are genotyped for a polymorphism in the R gene, which has two alleles, R1 and R2. The frequencies of each of the possible three genotypes are shown in the following table:

Genotype frequencies
Population R1R1 R1R2 R2R2
1 0.25 0.50 0.25
2 0.54 0.32 0.14
3 0.28 0.24 0.48
4 0.64 0.32 0.04

2. Calculate the frequency p of the R1 allele in each of the above populations.

Population 1: Population 3:

Population 2: Population 4:

3. Which of the above populations are in Hardy-Weinberg equilibrium at the R gene? List ALL that apply and show your calculations.
animus31
Garter
Garter
 
Posts: 3
Joined: Fri Nov 09, 2012 11:52 am

Postby Cat » Sat Nov 24, 2012 4:54 pm

For problem 1, paste sequences in Word and change font to Courier New. It would allow you to align them. Once you do that, you will see that seq. 4 does not fit. Thus, that seq. is of the reverse strand. You will need to create reverse complement of it.

For problem 2 you need to do the calculations. See this link:
http://en.wikipedia.org/wiki/Hardy%E2%8 ... _principle
Cat
King Cobra
King Cobra
 
Posts: 635
Joined: Thu Feb 14, 2008 7:40 pm

Postby animus31 » Tue Nov 27, 2012 12:25 pm

Thank you. One question 1, I guess i lack a basic understanding. What tells you that seq. 4 does not fit?
animus31
Garter
Garter
 
Posts: 3
Joined: Fri Nov 09, 2012 11:52 am


Postby Cat » Sat Dec 01, 2012 12:05 am

When you assemble your sequence it looks like you are assembling:

under
derst
rstand
anding

to get contig = understanding

the sequence that does not fit is the reverse complement.
Cat
King Cobra
King Cobra
 
Posts: 635
Joined: Thu Feb 14, 2008 7:40 pm


Return to Genetics

Who is online

Users browsing this forum: No registered users and 1 guest