Login

|
|
Population Genetics QuestionsModerator: BioTeam
4 posts • Page 1 of 1
Population Genetics QuestionsHere are 4 questions for which I would love some guidance. Thanks in advance.
1. You obtain the following sequences from different genomic clones from one region of the human genome. In the space below the sequences, align the sequences to make a single sequence contig, showing how the sequences overlap. (To make things fit, you may need to write small or wrap around!) NOTE: All six sequences read in a 5’ to 3’ direction. Five of the six sequences are from the same strand, but one is from the opposite strand so you will need to figure out which one it is and use its reverse complementary strand. Sequence 1: AACAAAAATGTTGTTATTTTTATTTCAGATG Sequence 2: TGTCTGCCATTCTTAAAAACAAAAATGT Sequence 3: ATGCGATCTGTGAGCCGAGTCTTTA Sequence 4: AATAACAACATTTTTGTTTTTAAGA Sequence 5: TGTTATTTTTATTTCAGATGCGA Sequence 6: TTCAGATGCGATCTGTGAGCCGAG Four maize populations are genotyped for a polymorphism in the R gene, which has two alleles, R1 and R2. The frequencies of each of the possible three genotypes are shown in the following table: Genotype frequencies Population R1R1 R1R2 R2R2 1 0.25 0.50 0.25 2 0.54 0.32 0.14 3 0.28 0.24 0.48 4 0.64 0.32 0.04 2. Calculate the frequency p of the R1 allele in each of the above populations. Population 1: Population 3: Population 2: Population 4: 3. Which of the above populations are in Hardy-Weinberg equilibrium at the R gene? List ALL that apply and show your calculations.
For problem 1, paste sequences in Word and change font to Courier New. It would allow you to align them. Once you do that, you will see that seq. 4 does not fit. Thus, that seq. is of the reverse strand. You will need to create reverse complement of it.
For problem 2 you need to do the calculations. See this link: http://en.wikipedia.org/wiki/Hardy%E2%8 ... _principle
4 posts • Page 1 of 1
Who is onlineUsers browsing this forum: No registered users and 0 guests |
© Biology-Online.org. All Rights Reserved. Register | Login | About Us | Contact Us | Link to Us | Disclaimer & Privacy