Login

Join for Free!
61551 members


Real Time reverse transcription PCR Questions

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderator: BioTeam

Real Time reverse transcription PCR Questions

Postby wessH » Sun Jun 03, 2012 2:21 pm

This is my first experience with any type of PCR. I've done a lot of reading and digging around but I need a little help to solidify my understanding of Real Time PCR from a mRNA sample (Real Time reverse transcription PCR).

The protocol I have in mind is to transfect my cells with my desired proteins and when I split my cell lysate I will keep one for protein and one to isolate RNA. Then I will extract mRNA and use reverse transcription to make cDNA.

I will be using the 2 step protocol. Do most people use premade primers for the reverse transcription step? Oligo dT are just for poly A tails, so you don’t have to customize those right?


I know this is a dumb question but I’m having trouble locating my exact gene sequence! My project is on IL6. I used NCBI to search and found IL6 [homo sapiens]. How do I find the sequence that I need? Is it under “NG_011640.1 RefSeqGene” OR “mRNA and proteins NM_000600.3”? When I click on NM_000600.3 it says it is mRNA but there are no U’s? Do I need to know the mRNA sequence for the reverse transcription step or do I just need to know the sequence of my cDNA so that I can make primers for the pcr step?



Once my mRNA is converted to cDNA, how do I make primers for cDNA? cDNA is the same orientation as DNA right? For example, lets say the NCBI website gives me the following sequence (please disregard if they are good primers or not due to GC% and Tm etc., I’m just trying to understand the theory):
TCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACA
I am under the impression that this is the sense strand, so it's 5' to 3', and that the cDNA is exactly the same sequence and orientation.

5' TCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACA 3' SENSE

3' CTCCATATGGATCTCATGGAGG 5' (Reverse Primer)
<<<<<<<<<<<<<<<<<<<<<<<<<<<<<

3' GGTTAGACCTAAGTTACTCCTCTGAACGGACCACCCTCAAACACCATATGGATCTCATGGAGGTCTTGT 5' ANTISENSE

5' AATCTGGATTCAATGAGGAGA 3' (Forward Primer)
>>>>>>>>>>>>>>>>>>>>>>>>


Basically, I just make my primers like I would for a normal PCR, from the DNA sequence provided by NCBI?

Why do I need to write my reverse primer like this: 5' CCTCCATGAGATCCATATGGAG 3'?

I’ve read that you want the primers to be within an exon and also that you want the primers to be at an exon-exon junction because that would eliminate genomic DNA contamination. Which one is correct and why?



I think I understand the concept behind adding restriction sites. They are added to the 5' end and you need to add 2-4 random bases after it so that the restriction endonucleases will be able to cleave the site when you insert it into a plasmid later on. Since it's on the 5' end, it will be present on the new template but the polymerase never interacts with the restriction site and the site does not match the DNA template strand. If the restriction site does not match with the template does that part just not bind and it floats during the extension round?

Does the following look correct?
5' CCTCCATGAGATCCATATGGAG 3' = 5' TCGXXXXXXCCTCCATGAGATCCATATGGAG 3'

X= Restriction Site, TCG= extra bases added on




As for the detection method for Real Time PCR, I am using this method to detect the expression levels (upregulated or downregulated) of mRNA in different samples, is it better to use probes or SYBR Green? Why?



This is a stupid question, but when making primers, how does one decide whether to use the sequence from a mouse vs human etc.? It's based on the samples that the lab has right? So if you are using patient samples you would need to base it off of the human sequence for that gene but if you are just using cell lines it would have to be from the source of the cell line?


Thank you, your help is very much appreciated!
wessH
Garter
Garter
 
Posts: 1
Joined: Sun Jun 03, 2012 2:03 pm

Return to Molecular Biology

Who is online

Users browsing this forum: No registered users and 0 guests