
Join for Free!
118491 members


Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderator: BioTeam


Postby genetherapy » Wed Nov 30, 2011 4:59 pm

Hi all,
I need help with primer design please. I want to design primers for Mus musculus GMCSF gene. I found it's cDNA but it's too long so I take a part of it where starts with the initiation codon ATG as follows:
1 ggtcagactg cccaggcagg gtgggaaagg cctttaaagc agcccgcagg tgggctgcca
61 gttcttggaa gggcttatta atgaaaaccc cccaagcctg acaacctggg ggaaggctca
121 ctggccccat gtatagctga taagggccag gagattccac aactcaggta gttcccccgc
181 ccccctggag ttctgtggtc accattaatc atttcctcta actgtgtata taagagctct
241 tttgcagtga gcccagtact cagagagaaa ggctaaggtc ctgaggagga tgtggctgca
301 gaatttactt ttcctgggca ttgtggtcta cagcctctca gcacccaccc gctcacccat
361 cactgtcacc cggccttgga agcatgtaga ggccatcaaa gaagccctga acctcctgga
421 tgacatgcct gtcacgttga atgaagaggt agaagtcgtc tctaacgagt tctccttcaa
481 gaagctaaca tgtgtgcaga cccgcctgaa gatattcgag cagggtctac ggggcaattt
541 caccaaactc aagggcgcct tgaacatgac agccagctac taccagacat actgcccccc
601 aactccggaa acggactgtg aaacacaagt taccacctat gcggatttca tagacagcct
661 taaaaccttt ctgactgata tcccctttga atgcaaaaaa ccaggccaaa aatgaggaag
721 cccaggccag ctctgaatcc agcttctcag actgctgctt ttgtgcctgc gtaatgagcc
781 aggaacttgg aatttctgcc ttaaagggac caagagatgt ggcacagcca cagttggaag
841 gcagtatagc cctctgaaaa cgctgactca gcttggacag cggaagacaa acgagagata
901 ttttctactg atagggacca ttatatttat ttatatattt atatttttta aatatttatt
961 tatttattta tttatttttg caactctatt tattgagaat gtcttaccag aataataaat
1021 tattaaaact ttt

I designed these primers but have no idea if it is good or not.
CAA: for protecting my restriction site during PCR
GCATGC: restriction site
ACC: Kozak sequence
I used pearlprimer,there it says for dimers:
Forward vs. Forward: -4.81 kcal/mol (Is it much?)
Forward vs. Reverse: -0.45 kcal/mol
Reverse vs. Reverse: -1.57 kcal/mol

My forward primer Tm is 60.78
My reverse primer Tm is: 59.79. But these Tm values are without restriction site,kozak sequence only ACCATGTGGCTGCAGAATTTA for forward and TTACCTGGGCTTCCTCATTTT for reverse. Should I calculate Tm with kozak, restriction site included again??
I will be grateful if someone help me please, it is very important for me
Thank you
Posts: 33
Joined: Fri Nov 11, 2011 9:54 am


Postby genetherapy » Thu Dec 01, 2011 9:53 am

Don't anyone know primer design? Please I really need help to start my reseach project. It is my first time designing primer so I have no idea if I do the design right or not?

Kindly request you to give a hand
Posts: 33
Joined: Fri Nov 11, 2011 9:54 am

Postby bravebeaker » Tue Dec 06, 2011 8:46 am

I would really like to know too! honestly there are so many ways and methods on web I found. The thing is maybe I dont have the courage to apply it without returning to an experianced person!
Will follow up the thread...
AHH, Gravity! Such a cold cruel mistress.
User avatar
Posts: 44
Joined: Sun May 08, 2011 3:26 am
Location: Kobe, Japan

Postby DougB » Wed Apr 18, 2012 2:22 pm

Sorry I was not able to respond to your question earlier. Unfortunately, I just joined. Hopefully I still could provide some assistance.

There are several guidelines for designing primers for PCR or sequencing. (1) The primer length should range 18 to 22 bases. Your primers are 21 bases in length and should be okay. (2)50 to 60 percent GC content. Your primers have 43 percent GC content. However, since they are 21 bases in length, this should also be okay. (3) Should have a GC lock. 2 of 3 of the 3 prime bases should be G or C with the final 3 prime base G or C. The primers you have listed are AT rich along the 3 prime end. They could still work as many primers lacking the GC lock have before. But it is a guideline to remember in the future.

Specifically for PCR forward and reverse primers, the Tm values should be within 4 degrees.

I would recommend including the Kozak sequence and restriction site in the Tm values. Basically you have tailed 21 base length primers with these added sequences. During the first round of PCR, the additional bases will be included in the amplified product. Therefore, the Kozak sequence and restriction site will become part of the priming site.

Hopefully you will find this information helpful at this late date.

Doug B
Posts: 9
Joined: Mon Apr 16, 2012 8:06 pm

Postby DougB » Wed Apr 18, 2012 2:28 pm

Sorry, I forgot to add one thing. I reviewed the primer sequence for secondary structure. It appears as though the forward primer has a 5 base compliment to itself (CTGCA). This likely accounts for the higher potential of primer dimer. Probably not to big of a concern. The reverse primer actually has a 7 base compliment to the product sequence beginning at base 308. I think your primers are okay for both.

Doug B
Posts: 9
Joined: Mon Apr 16, 2012 8:06 pm

Return to Molecular Biology

Who is online

Users browsing this forum: No registered users and 1 guest