Biology-Online • View topic - promoter mutations effects
Login

Join for Free!
121770 members
Advertisement
Advertisement
Advertisement


promoter mutations effects

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderator: BioTeam

promoter mutations effects

Postby aves » Sun Nov 20, 2011 5:52 pm

There is dna sequence, I find promoter regions on this sequence and question that: (- 35 REGİON: TTGACA, -10 REGİON: TCCAAT)
Please answer mutation questions on Pribnow sequences
1-change last T residue of pribnow sequence to A,
2-change first A residue of pribnow sequence to T residue,
Please answer mutation question on -35 sequences
1-change second T residue of -35 sequences to A residue,
2-change C residue of -35 region to A residue
What are the affects of these mutations on transcription?
sequence:
5’cttgccatgctaaaggacgtcacattTTGACAgcacaatcttaataaggtttgacatTCCAATcagccccaccttgacacgctctggcccccttgccatgctaaaggacgtcacattttgacagcacaatcttaataaggtttgcttgccatgctaaaggacgtcacattttgacagcacaatcttaataaggtttgttgacactttatgcttccggctcgtataataccctcaccctccaacatgaggatttgcgcatgaccacaatggcggccgccaccctgctgcgcgcgacgccccacttcagcggtctcgc
cgccggccggaccttcctgctgcagggtctgttgtgaccacaatagtaacatccctagacgtaagcggcttttttgcagggtttttgggccctaaaggctccttttggagcctttttttgagcagggtttttgggcccgggctaaaggacgtcacattttgatttttgggcccgggctaaag-3
aves
Garter
Garter
 
Posts: 2
Joined: Sun Nov 20, 2011 5:34 pm

Postby daniel.kurz » Mon Nov 21, 2011 2:27 am

Read your textbook? This sounds like homework that you were assigned for a molecular genetics course.
daniel.kurz
Coral
Coral
 
Posts: 167
Joined: Fri May 19, 2006 1:47 am

Postby aves » Mon Nov 21, 2011 7:43 am

yes this is my homework, but the problem is that; there is no textbook! can you help?
aves
Garter
Garter
 
Posts: 2
Joined: Sun Nov 20, 2011 5:34 pm



Return to Molecular Biology

Who is online

Users browsing this forum: No registered users and 1 guest

Advertisement