Login

|
|
DNA sequencing problem that I'm absolutely stumped byModerator: BioTeam
2 posts • Page 1 of 1
DNA sequencing problem that I'm absolutely stumped byHey guys. It would be awesome if you could help me with this question. I have absolutely no clue how to go about it.
Consider the following DNA sequence: AATATCAATGAATGTCATAGTGTCACTAAGGATGC Assume you have available the follwing resources to hand-annotate the sequence above: EST E1 (expressed sequence tag): CAATGAATTG EST E2: CCTTAGT Proteins: Met Asn Cys His Identify: 5' UTR 3' UTR And the full length mRNA.
I will split you sequence a little
you have: AATAT than there is EST1 (although with one mutation, you probably wrote it wrong CAATGAATGT than some other sequence CATAGTGTC and EST2 (in reverse complement;) ACTAAGG and the end... ATGC but I'm littlw confused with the ORF, it doesn't seem to work. Just look for all ATGs and subsequent stop codons http://plato.stanford.edu/entries/infor ... icCode.png (look if you have correct sequence;) http://www.biolib.cz/en/main/
Cis or trans? That's what matters.
2 posts • Page 1 of 1
Who is onlineUsers browsing this forum: Google [Bot] and 1 guest |
© Biology-Online.org. All Rights Reserved. Register | Login | About Us | Contact Us | Link to Us | Disclaimer & Privacy