Login

Join for Free!
112143 members


DNA sequencing problem that I'm absolutely stumped by

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderator: BioTeam

DNA sequencing problem that I'm absolutely stumped by

Postby crouch88 » Tue Apr 20, 2010 2:18 am

Hey guys. It would be awesome if you could help me with this question. I have absolutely no clue how to go about it. :(

Consider the following DNA sequence:
AATATCAATGAATGTCATAGTGTCACTAAGGATGC

Assume you have available the follwing resources to hand-annotate the sequence above:

EST E1 (expressed sequence tag)
: CAATGAATTG
EST E2: CCTTAGT
Proteins: Met Asn Cys His

Identify:
5' UTR
3' UTR

And the full length mRNA.
crouch88
Garter
Garter
 
Posts: 1
Joined: Tue Apr 20, 2010 2:15 am

Postby JackBean » Tue Apr 20, 2010 6:55 am

I will split you sequence a little

you have:
AATAT
than there is EST1 (although with one mutation, you probably wrote it wrong ;)
CAATGAATGT
than some other sequence
CATAGTGTC
and EST2 (in reverse complement;)
ACTAAGG
and the end...
ATGC

but I'm littlw confused with the ORF, it doesn't seem to work. Just look for all ATGs and subsequent stop codons
http://plato.stanford.edu/entries/infor ... icCode.png

(look if you have correct sequence;)
http://www.biolib.cz/en/main/

Cis or trans? That's what matters.
User avatar
JackBean
Inland Taipan
Inland Taipan
 
Posts: 5652
Joined: Mon Sep 14, 2009 7:12 pm


Return to Molecular Biology

Who is online

Users browsing this forum: No registered users and 1 guest

cron