Login

Join for Free!
25747 members


Help with sequencing DNA.

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderator: BioTeam

Help with sequencing DNA.

Postby Melany87 » Sat Jun 27, 2009 2:39 am

Alright, I am struggling to find the informational DNA sequence and anti-sense DNA sequence to the resulting informational DNA sequence for the following mRNA sequence:

5' A AG G G U G U A G A A G C U A A G G G U 3'

I contrived the following answers for information sequence, but I do not know if I am correct...
3' T TC C C A C A T C T A C G A T T C C C A 5'

The resulting anti-sense would be:

5' A AG G T G T A G A T G C T A A G G G T 3'

Is that right, or what because I have no found clear distinct guidance in my biology book concerning this...

Any help or guidance is appreciated.
Melany87
Garter
Garter
 
Posts: 2
Joined: Sat Jun 27, 2009 2:35 am

Re: Help with sequencing DNA.

Postby Melany87 » Sat Jun 27, 2009 3:19 am

Ermm.... I noticed on the 2nd AA I stated TA instead of TT and, of course, the antisense would change subsequently.
Melany87
Garter
Garter
 
Posts: 2
Joined: Sat Jun 27, 2009 2:35 am

Re: Help with sequencing DNA.

Postby kolean » Sat Jun 27, 2009 1:37 pm

Melany87 wrote:5' A AG G G U G U A G A A G C U A A G G G U 3'


this is the mRNA, then the sense/coding DNA is the same, but the U's are T's in DNA:

5' A A G G G T G T A G A A G C T A A G G G T 3'

the anti-sense/informational DNA is the opposite:

3' T T C C C A C A T C T T C G A T T C C C A 5'

but most times it is written in the 5' to 3':

5' A C C C T T A G C T T C T A C A C C C T T 3'
Last edited by kolean on Mon Jun 29, 2009 10:45 pm, edited 1 time in total.
kolean
Coral
Coral
 
Posts: 169
Joined: Thu Jun 25, 2009 3:15 am

Re: Help with sequencing DNA.

Postby jonmoulton » Mon Jun 29, 2009 4:47 pm

For this mRNA:
AAGGGUGUAGAAGCUAAGGGU

The antisense is likely:
ACCCTTAGCTTCTACACCCTT

The sense is likely:
AAGGGTGTAGAAGCTAAGGGT

All sequences are written in standard 5' -> 3' direction.

The reason I write "likely" is that there might be a pre-mRNA splicing event within the sequence that produces the mature mRNA strand. If so, the DNA sequence would be interrupted by an intron.

If there is no splicing event, the mRNA sequence is the same as the sense sequence. Be careful, this is not how the sequences were shown in some of the previous discussion.
User avatar
jonmoulton
Viper
Viper
 
Posts: 156
Joined: Fri Feb 15, 2008 5:38 pm



Return to Molecular Biology

Who is online

Users browsing this forum: No registered users and 0 guests