Login

Join for Free!
25667 members


Quick Question-

Discussion of all aspects of biological molecules, biochemical processes and laboratory procedures in the field.

Moderator: BioTeam

Quick Question-

Postby vithuramaharajah » Fri Apr 17, 2009 9:55 pm

In the following paragraph, many strands are used, how did they use each strands for the preparation of mutant TCR library?

Construction of 2C CDR3α DNA library
2Cα and 2Cβ cDNAs, were cloned into the murine stem cell virus (MSCV) retroviral vector in a bicistronic configuration of 2Cα-IRES-2Cβ (kindly provided by Phil Holler and Jianzhu Chen, MIT). The 5 codon amino acid degeneracy library in CDR3α of the 2C TCR (GFASA, positions 99–103) was created by overlap extension PCR. SOE-PCR-overlap regions between two preSOE products are underlined. AgeI upstream primer, sense strand: 5′

GGAATTAGATCCACCGGTCGCCGCCATGCTCCTGGACTCCTCCCAGTGCTGGGG 3′; CDR3α 5 codon degeneracy primer, anti-sense strand: 5′ caatgacttttgtgccagatcca aatgtCAGSNNSNNSNNSNNSNNgctCACAGCACAGAAGTACACAGCCGAGTCGCTCC 3′ and CDR3α SOE Overlap Primer, sense strand: 5′ GGATCTGGCACAAAAGT CATTGTTCTACCATACATCCAGAACCCAGAACC 3′; Calpha NotI reverse primer, anti-sense strand: 5′ CGGAATTCTAGAGTCGCGGCCGCTTTACTTGTACATTATC AACTGGACCACAGCCTCAG 3′ (Integrated DNA Technologies). The 869 base-pair SOE product VαCα cassette with 5 codon degeneracy spanning CDR3α was ligated into the MSCV vector as a AgeI-NotI fragment. Ligation was performed with T4 DNA ligase (New England Biolabs) with a 2/1 insert to vector ratio.
vithuramaharajah
Garter
Garter
 
Posts: 1
Joined: Fri Apr 17, 2009 6:24 pm

Postby LifeTein » Sat Apr 25, 2009 2:32 pm

This is just a pcr method to get your mutant library. You use your primer with SNNSNNSNNSNNSNN for regular PCR. Ligate the products to the vector and clone. You get your transformants with diversity of 2x4x4^5, if I am not wrong.
James Chou, Ph.D.
http://www.lifetein.com
Understanding Life One Protein at a time...
The Peptide Synthesis Service Company...
User avatar
LifeTein
Garter
Garter
 
Posts: 8
Joined: Wed Apr 08, 2009 4:24 pm
Location: NJ


Return to Molecular Biology

Who is online

Users browsing this forum: No registered users and 1 guest