Login

|
|
nucleotidesModerator: BioTeam
2 posts • Page 1 of 1
nucleotidesI have no idea with this question.
A piece of mRNA is 660 nucleotides long but the DNA coding strand from which it was is transcribed was 870 nucleotides long. i) Explain the difference in the number of nucleotides. ii) What is the maximum number of amino acids in the protein translated from this piece of mRNA? Explain your answer please. thanks.
Re: nucleotidesThe coding strand of the DNA is made up of introns (non-coding parts) and exons (coding parts). when the mRNA is transcripted from the DNA it includes all the corresponding parts (both the introns and exons) but then the mRNA is spliced, which is where the introns are taken out. because some are taken out it will be shorter.
For example: (the bold and underlined letters are the exons) Coding DNA: TACCGAATAAACGCCGGCCATC non-spliced mRNA: AUGGCUUAUUUGCGGCCGGUAG spliced mRNA: AUGGCUUUGCGGUAG as you can see all the introns (non-bold and non-underlined) parts have been taken out. The DNA sequence you are looking at has 870 nucleotides and the mRNA only has 660. therefore there must be 210 intron nucleotides which have been spliced. As for the second part of the question: 3 nucleotides (called a codon) code for an amino acid. and proteins are made up of amino acids. therefore there must be a maximum of 220 amino acids ( 660 divided by 3) hope this helped. dont hesitate to ask if you need more explaining
2 posts • Page 1 of 1
Who is onlineUsers browsing this forum: No registered users and 0 guests |
© Biology-Online.org. All Rights Reserved. Register | Login | About Us | Contact Us | Link to Us | Disclaimer & Privacy
Science Network - Braintrack.com - University Directory | Chemicool.com - Chemistry | Logo design by LogoBee | Powered by phpBB