Login

Join for Free!
61201 members


Theories - Origin of Life

Discussion of everything related to the Theory of Evolution.

Moderator: BioTeam

Re: Theories - Origin of Life

Postby scottie » Mon May 16, 2011 8:37 pm

First things first
"I believe in a designer that can design the cell."


If you are going to quote me then do it accurately. Please don’t attribute comments to me I have not made.

This is what I wrote. “Now Regarding the designer of the cell.” And it was in In response to your question
Nowhere will you find that I have said “I believe in a designer”

The only belief I have clearly enumerated is that I believe in the veracity of the scientific method. I also stated my understanding of the scientific method.

It seems very clear now that you are trying very hard to engage in a philosophical debate.

I have repeatedly stated that the cell displays all the evidence of functional design and not the product of random variation.

I have also stated quite clearly that random mutations cannot produce the functional design clearly observed in cell operations and have given scientific reasons why this is so.

Now if the reasons I have provided can be shown to be scientifically inaccurate then please do correct me. If not then my argument stands, because it is based on scientific and not wishful thinking.

You are still evading the issue of species definition so I will give up on getting that from you. :)
However you have committed to a definition of the
“The designer positted by modern biology”


You state
The designer positted by modern biology is well defined. Mostly (if not completely) random changes in the genetic material of preexisting organisms ( or almost living chemical systems capable of some crude form of replication) provide variation in the population. Selection (natural, sexual, domestication) removes variations that don't fit in an available niche. The remaining organisms reproduce. Repeat, repeat ,repeat.


Now I must presume that you regard this to be a statement of scientific validity.
So let me examine it.
( or almost living chemical systems capable of some crude form of replication)


Could you explain what are “almost living chemical systems” ?

Also please describe what you mean by “some crude form of replication”?

Mostly (if not completely) random changes in the genetic material of preexisting organisms provide variation in the population.

This part of your definition is about variation within existing population is it not?

Selection (natural, sexual, domestication) removes variations that don't fit in an available niche. The remaining organisms reproduce.


This again is about variation within an existing population is it not?
You appear to be agreeing with me,

Things you wouldn't expect to see. Perfection, this process is a little messy. Completely new designs with no previous history. Virgin birth
(Spontaneous generation)


This is simple rhetoric that doesn’t seem to make a great deal of sense.
Are you saying that Virgin birth (whatever that is) is spontaneous generation?

Notice I don't mention your arguement. Complexity is not evidence against this process.

Whose is arguing that complexity is evidence of design. Design can be simple or complex and I gave examples in my previous post.

Please address what I am writing and not make up arguments you wish to attack. I think they are called straw man arguments.

Life doesn't violate any thermodynamic laws.


Who say’s it does?

Organic molecules are perfectly capable of creating bizarrely complex systems without intelligent input.


How?

If you find a watch on the beach it is perfectly logical to look around for the owner/maker. If however you find a crab on the beach there is no reason to look for it's creator. It's pretty likely other crabs were involved.

Do you not see the obvious contradiction between this statement and your opening statement.
WRONG, If you posit a designer it is incumbant on you to define as much as you can and attempt to prove/ disprove it.


So if the design of crab is as you claim the product of random mutations and natural selection then it is also as you put it
“incumbant on you to define as much as you can and attempt to prove/ disprove it.”

So how does the mechanism of random mutations produce the biological algorithms we observe in the cell?

Now here is an example of such a algorithm.

IF lactose present. AND glucose not present. AND cell can actually synthesize active LacZ and LacY. THEN transcribe lacZYA from lacP ...

You will find an explanation of this here

http://books.google.com/books?id=WSf1FF ... 22&f=false

Now if you have any difficulty in understanding how algorithms work don’t worry I will explain it all scientifically.
scottie
Coral
Coral
 
Posts: 214
Joined: Tue Apr 12, 2011 9:41 pm

Postby BDDVM » Tue May 17, 2011 12:43 am

Apparently it boils down to the fact that you can't imagine or can't allow yourself to imagine that these complex systems, algorhythms if you will, evolved.
I and the rest of the scientific community have no problem imagining this evolution process producing all the life we see, both alive and extinct. There is a reason it's considered one of the greatest theories ever.
Don't get too hung up on the species concept, evolution obviously doesn't.
I apologize for misquoting your apparent arguments about a designer.
You've left some significant gaps in your definition which I had to guess at. I was left assuming that you fall into the catagory of creationist/ Intelligent designist. If this is not true I sincerly apologize. If it is true just say so and quit avoiding putting your beliefs out where they can be debated.
BDDVM
Death Adder
Death Adder
 
Posts: 76
Joined: Sat Nov 13, 2010 3:24 am

Postby canalon » Tue May 17, 2011 12:55 am

So if I understand your problem with evolution:
- The cell, or living organisms cannot have arisen de novo because nothing comes from nothing
- And self organizing complexity cannot arise spontaneously from chemistry alone
- Ergo There must have been something that designed it.

But you cannot say what that designer might be, or where it comes from, or anything substantial about it. So your Scientific conclusion is that there must be a designer because you cannot imagine anything else, but because you are a scientist you will not say anything about it because that would be philosophy. Great. I am temepted to say that once summarized your argument is a bit crap.
Patrick

Science has proof without any certainty. Creationists have certainty without
any proof. (Ashley Montague)
User avatar
canalon
Inland Taipan
Inland Taipan
 
Posts: 3908
Joined: Thu Feb 03, 2005 2:46 pm
Location: Canada

Re: Theories - Origin of Life

Postby scottie » Tue May 17, 2011 9:18 pm

BDDVM

I and the rest of the scientific community have no problem imagining this evolution process producing all the life we see, both alive and extinct.


You have summed up your position very well indeed. It is all in your imagination.
I respect you for acknowledging that.

Also you are right about me. I don’t have those imaginative powers. It is a failing I have I must admit.

Don't get too hung up on the species concept, evolution obviously doesn't.


Now this is a very interesting statement. Am I not correct in understanding that your position is Darwinian based. Is it not also true that his seminal work is entitled “ Origin of Species….”. I have read his work and the term species keeps coming up with almost monotonous regularity. Very strange!!!!

I was left assuming that you fall into the catagory of creationist/ Intelligent designist.


Why are you left assuming?
This is what I wrote on the 14th April.

by scottie » Thu Apr 14, 2011 9:57 pm

But before we go any further I would like to make one thing clear. I am neither a creationist nor an advocate of the ID community.

I have made a study of the various denominations of evolutionary thinking, and there are several, and all coming up with separate ideas.

I have similarly made a study of the bible though not the Qu'ran and the religious churches of Christendom and Islam again come up with different ideas, each one claiming they are right.

Science is my interest.
Science in my opinion should not be tied to any philosophy.

Now how much clearer do you wish me to be?
I would be happy to sign some kind of affidavit if you wish. :)

However apologies accepted.

If it is true just say so and quit avoiding putting your beliefs out where they can be debated.


My belief system is out there to be debated but you don’t appear to want to.

Why are you having such a problem with my belief in the veracity of the scientific method?

I appreciate you don’t have the same faith in it’s veracity as I do, but my faith is very much evidenced based.

That is why I have gone to such great lengths to provide the information from science papers and publications to demonstrate my absolute confidence in my belief.
scottie
Coral
Coral
 
Posts: 214
Joined: Tue Apr 12, 2011 9:41 pm


Re: Theories - Origin of Life

Postby scottie » Tue May 17, 2011 9:31 pm

canalon
So if I understand your problem with evolution:
- The cell, or living organisms cannot have arisen de novo because nothing comes from nothing
- And self organizing complexity cannot arise spontaneously from chemistry alone
- Ergo There must have been something that designed it.


You’re looking through the wrong end of the telescope.

I don’t have any problems with evolution. I know evolution occurs. I also know the limits of what it can accomplish and what it cannot.

With respect you are the one with the problems. You don’t accept the limits that prevent speciation but are unable to support that understanding with evidence.

You still adhere to the idea of common decent and yet molecular biology now demonstrates that this hypothesis has been falsified. I have provided you with the evidence and you take no note. I can do no more than to keep trying to educate.

And self organizing complexity cannot arise spontaneously from chemistry alone


That is correct, however it does not have to be very complex.

There is a tendency for some to confuse self ordering with self organising.

Self ordering can and does happen. Tornadoes and whirlpools are examples of self ordering, and chaos theory well explains those phenomena.

Self organising however, of which the cell is a prime example cannot be explained by the action of any natural law(s). The origin of the codes operating within the cell can only be speculated at because natural laws do not produce the symbolic information that is clearly evident.

But you cannot say what that designer might be, or where it comes from, or anything substantial about it. So your Scientific conclusion is that there must be a designer because you cannot imagine anything else, but because you are a scientist you will not say anything about it because that would be philosophy. Great. I am temepted to say that once summarized your argument is a bit crap.


You are right I cannot define the designer of the cell. But then nor can you. You tried to demonstrate how natural laws came about and look at the hopeless tangle you got yourself into.
Come on now be honest, you made a right pigs ear of it didn’t you?
Nothing to be ashamed of though, science can’t answer questions like that, you were just a little bit silly to try.

Religions however supposedly can. All they have to do is construct a dogma and that explains it. Darwinism has become a dogma, no differently.

Now I know this cuts across your belief system, but you are making the claim that you have science on your side.

When I explain and show that you don’t have science on your side, it gets frustrating and shows up in your deteriorating language.

Finally, on this question of naming the designer, May I relate a little sad story from about October 2001.

Three very hardworking guys discovered a quite amazing control system and were put up to receive a prize for all their hard work and ingenuity.

However the prize panel while recognising their tremendous work realised it fell significantly short because they were unable to tell who was the designer of the system. Sadly therefore this system had to be classified as non-designed in the same way as the wheel or the abacus.

However the panel did feel they deserved some recognition so they awarded them a consolation prize.

You will find the whole sad tale here
http://nobelprize.org/nobel_prizes/medi ... press.html
scottie
Coral
Coral
 
Posts: 214
Joined: Tue Apr 12, 2011 9:41 pm

Postby canalon » Tue May 17, 2011 10:22 pm

Scottie,

You miss the point, I do not care if you are a creationist, an IDiot, or simply thick. What i am trying to argue is that the theory of evolution is the only theory that fits and explains life as we see it. If you argue that self organization cannot happen, you have to explain where the organization comes from, what the designer is in other word. It is not a name that I want, but an idea of what the designer is, where it comes from. The point is that your affirmation that self organization is impossible, besides lacking demonstration, throw your reasoning in a recursive loop, and I am curious to know how you get out of it.
But if you provide a reasonned and undestandable model for design, I promise that I will definitely reconsider my views on evolution. Right now however, you seem limited to say that there must be a designer and therefore evolution is wrong. Sorry that does not work. Offer something consistent.
As for your story it is simply irrelevant to the discussion.
Patrick

Science has proof without any certainty. Creationists have certainty without
any proof. (Ashley Montague)
User avatar
canalon
Inland Taipan
Inland Taipan
 
Posts: 3908
Joined: Thu Feb 03, 2005 2:46 pm
Location: Canada

Postby BDDVM » Wed May 18, 2011 12:32 am

I'm fascinated with this designer. Please can we have some details that we may use to make our daily lives better.
BDDVM
Death Adder
Death Adder
 
Posts: 76
Joined: Sat Nov 13, 2010 3:24 am

Re: Theories - Origin of Life

Postby scottie » Fri May 20, 2011 8:09 pm

canalon
But if you provide a reasonned and undestandable model for design, I promise that I will definitely reconsider my views on evolution.


That is a very reasonable question so let’s see if I can provide a scientifically satisfying answer.

I will start with an illustration in symbolic representation. Please bear with me.

A person walking past a house notices the roof is on fire. He also is aware that someone is in the house. He has no way of communicating with the householder as he is a deaf mute.

He notices that the front yard is laid with loose pebbles.
He goes into the yard and arranges some of the pebbles of a particular colour to read.
“Roof on fire Get out”
The householder reads the pebbles and escapes.
Now what has gone on here?

The yard pebbles in themselves have no meaning. They are inert, just lumps of pebble molecules.

The passer-by arranged some of the pebbles in such a way as to put a meaning into them. In other words he coded some of the pebbles to convey meaning.

Now the householder had to decode the pebble arrangement. IF he could not understand written English, the message would be meaningless to him. In other words the pebbles would have remained inert to him because he could not decode the pebble arrangement and therefore no function (his escape) would take place.

This is the essence of Shannon communication.
A Coder is required – the passerby
A Channel of communication required – the pebbles
A Decoder is required – the householder.

There is another element that needs to be considered. NOISE.

If for instance the pebble arrangement starts to get messed up due to wind or heavy rain or the householder simply running across it, the arrangement begins to get corrupted. This is noise. Now the coder would have to keep rearranging the pebbles to retain meaning.

The important thing to keep in mind is that the pebbles in themselves carry no meaning. They are inert.
The meaning that is put into the arrangement comes from outside—The passer-by.
He uses a code (written English) and importantly the householder understands that code and can act on it.

Now it is this method of communication that the cell uses.

Here is an example of a fairly simple regulatory system.

The lac operon in E. coli and other bacteria is an example of a simple regulatory circuit. In bacteria, genes with related functions are often located next to each other, controlled by the same regulatory region, and transcribed together; this group of genes is called an operon. The lac operon functions in the metabolism of the sugar lactose, which can be used as an energy source. However, the bacteria prefer to use glucose as an energy source, so if there is glucose present in the environment the bacteria do not want to make the proteins that are encoded by the lac operon. Therefore, transcription of the lac operon is regulated by an elegant circuit in which transcription occurs only if there is lactose but not glucose is present in the environment.

http://ocw.mit.edu/courses/electrical-e ... note01.pdf

James Shapiro describes refers to this simple but excellent example of cell coding for function.

"IF lactose present AND glucose not present AND cell can synthesize active LacZ and LacY, THEN transcribe lacZYA from lacP."

The symbols IF AND THEN in this simple functional code have meaning but that meaning in NOT in the molecules themselves.( as in the pebbles) As James Shapiro himself says. They are inert.
http://shapiro.bsd.uchicago.edu/21st_Ce ... _Evol.html ( Please spend some time reading it. You will find it very instructive.)

The expression THEN is what is referred to as a Decision Node. These nodes are required in a genetic algorithm for function to take place. Without these decision nodes natural laws take everything forward and is explained very well in chaos theory.

Notice also the expressions IF and AND. These expressions introduce potential into the algorithm. (the algorithm looks forward to note if a particular situation exists and IF it exists then move forward this way). Now when potential is recognised in an algorithm then natural mechanistic laws cannot be involved in that decision making process simply because moving forward takes the course of the algorithm and not natural law.

Now the meaning of these symbols comes from the cell itself.
A good question can be …
How did that meaning come about? But that question does not hinder the science of trying to understand how the cell works. Does it?

If you read David Abel’s and Jack Trevor’s paper “Three subsets of sequence complexity and their relevance to biopolymeric information”
You will find it here
http://www.tbiomed.com/content/2/1/29

They clearly show that this symbolic meaning cannot arrive in any natural materialistic way and have shown why this is not possible even in theory.

They have put forward 4 Null Hypothesis and invites them to be falsified.
To date there has been no success.
Science only deals with the materialistic world of natural laws.

Shapiro uses the expression Natural genetic engineering because he philosophically wants the answer as to the origin of this process to come from a naturalistic cause. If you removed the adjective Natural from his descriptions of cell functions, the explanatory power of his papers does not diminish in the slightest.

Is there anything wrong with his use of that adjective? Well NO.
It just needs to be recognised what the science is and what the philosophy is.

All too often the boundary between science and philosophy gets very very blurred.

Darwinian evolution that has developed into today’s Modern Synthesis is in reality a Null Hypothesis. This null hypothesis is being falsified by the science of molecular biology.

Random mutations cannot produce symbolic representation. Random mutation is the NOISE that degrades symbolic representation. The cell’s genetic engineering repair systems work at eliminating that noise.

The irony of this is, that noise in an information channel degrades the information content and engineers spend great time and effort in reducing that noise in order to maintain clarity of information. Darwinian theory on the other hand is based on noise being the instrument that drives forward progress.
It totally contradicts Shannon information theory.

Practically every molecular biologist around the world is discovering what James Shapiro is so ably presenting, in showing that the Darwinian process is simply not the mechanism that explains speciation. That mechanism is simply not known.

In my next post in a couple of hours I will try and provide another example that visually is more instructive.
scottie
Coral
Coral
 
Posts: 214
Joined: Tue Apr 12, 2011 9:41 pm

Postby canalon » Fri May 20, 2011 9:02 pm

And will you make any progress toward answering the question?

"If design cannot be spontaneous, where/how did the designer originate?"
Patrick

Science has proof without any certainty. Creationists have certainty without
any proof. (Ashley Montague)
User avatar
canalon
Inland Taipan
Inland Taipan
 
Posts: 3908
Joined: Thu Feb 03, 2005 2:46 pm
Location: Canada

Re: Theories - Origin of Life

Postby scottie » Fri May 20, 2011 9:30 pm

Let’s take another example but this time with far more selective power. I will try to make it more visually descriptive to demonstrate the process.
tRNA biosynthesis
DNA molecule carries the instructions which are absolutely necessary to produce enzymes, different nucleotide complexes, and smaller protein molecules used in the processes of transcription and translation. One of such important tools are tRNA molecules. Each living cell constantly utilizes some 40 different forms of the tRNA molecule.

We will look at the yeast DNA gene for tRNA tyr
The tRNATyr gene has to be found in one of the chromosomes. Here that gene is represented with the aid of the four symbols A, C, G, T, substituted for the rather complex chemical formulas of four the different deoxyribonucleotides:

Here it is.
GTTATCAGTTAATTGACTCTCGGTAGCCAAGTTGGTTTAAGGCGCAAGACT GTAATTTACCACTACGAAATCTTTGAGATCGGGCGTTCGACTCGCCCCCG GGAGATT

Don’t worry about the exact meaning of this sequence just note the configuration changes as they come along.

The DNA gene has to be copied (transcribed). The gene remains intact in the structure of the given chromosome. The subunits of the copy are made from a different kind of sugar (not deoxyribose, but ribose), and one of the original organic bases (T) is substituted by another one (U):

So the early RNA transcript of the gene is

GUUAUCAGUUAAUUGACUCUCGGUAGCCAAGUUGGUUUAAGGCGC AAGACUGUAAUUUACCACUACGAAAUCUUUGAGAUCGGGCGUUCG ACUCGCCCCCGGGAGAUU (notice the T’s are now U’s)

Both the tRNATyr gene and its faithful RNA copy consist of four different units linked in a sequence 104 subunits long. Now this may seem to us quite random, but in fact it is absolutely non-random, i.e. this specific sequence is closely correlated with the final, functional properties of the tRNATyr molecule. Virtually any change in this sequence makes it unfit to fill properly its job in the cell.

This non-randomness is usually called selectivity.

This RNA copy dictated by the structure of the tRNATyr gene undergoes many further complex modifications before it changes into the functional primary or mature structure of the tRNATyr molecule.
Parts of the precursor 1 copy have to be removed. The removed elements are written in lowercase red

guuaucaguuaauugaCUCUCGGUAGCCAAGUUGGUUUAAGGCGCAAGA CUGUAAuuuaccacuacgaaAUCUUUGAGAUCGGGCGUUCGACUCGCCC CCGGGAGAuu

Which give us Precursor 2

CUCUCGGUAGCCAAGUUGGUUUAAGGCGCAAGACUGUAAAUCUUU GAGAUCGGGCGUUCGACUCGCCCCCGGGAGACAA

Several single units have to undergo a transformation. The transformed elements are the final, functional primary structure of the yeast tRNA Tyr

CUCUCGGUAGmCCAAGDDGmGDDDAAGGCGmCAAGACUGPsAAiA
PsCUUUGAGADCmGGGCGTPsCGAmCUCGCCCCCGGGAGACCA

Have a look again at the early RNA transcript of the tRNA gene dictated by the sequence of the DNA gene the early RNA transcript of the gene - the supposedly unique source of information

GUUAUCAGUUAAUUGACUCUCGGUAGCCAAGUUGGUUUAAGGCGC AAGACUGUAAUUUACCACUACGAAAUCUUUGAGAUCGGGCGUUCG ACUCGCCCCCGGGAGAUU

The final, functional primary structure of the yeast tRNATyr differs considerably from the original DNA gene.
It is shorter than the gene - just 78 subunits long, but it is composed not from four but from eleven different subunits.

The original DNA gene is simply a very rough and incomplete information set that is required to produce the function it is required to. It has to be modified

The process of modifying the raw precursor involves a considerable increase in the selectivity of the product. This increase is over 1000 fold.

In other words the selectivity guaranteed by the DNA gene is insignificantly small in comparison with the selectivity really needed and actually somehow provided.

So where does this enormous selective power reside? We don’t know.

About 14 years ago mRNA editing was discovered. This means that the DNA genes, in some cases, do not determine the proper sequence of amino acids. The information provided by DNA messages is - in these cases -simply wrong, from the functional, biological point of view, and it has to be edited during a separate stage. As a result of this editing the original, primary molecular meaning of a given gene can be radically changed.


If DNA is the main ruling agency of the body mechanisms, then any mutilation of the DNA molecule should be fatal and unrecoverable. In reality DNA can, and is constantly being repaired. Somehow the organism knows how to detect a change in the genetic message, and utilizes many different, complex procedures to repair different forms of mutation.

Here is another spanner in the works of the one gene one function concept
http://www.sciencemag.org/cgi/content/a ... +One+Codon,
As the abstract concludes
“Thus, the genetic code supports the use of one codon to code for multiple aminoacids.”

In linguists we have homonyms, one word having two meanings. The meaning is determined by the context. ( bear –an animal but also to carry something) the context determines the meaning.)
So here we have the cell displaying a quasi-linguistic capability.

How did that meaning come about? Also where does that algorithm reside.
The simple answer is we do not know.

The present, almost completed inventory of the cell certainly does not contain any complex set of structures that we can identify with this type decision making code (and there are countless numbers of this information storage)

In a computer for instance we find these algorithms written onto the hard drive. But with the cell we have no idea as yet where these algorithms reside.

What is clear though is that symbolic information that is so clearly evident has to come from somewhere. It does not reside in the chemical nature of the molecules.

Random mutilation of DNA for example does not provide the prescriptive information that we see in cell operation.
In communication theory mutilation of any data is regarded as noise. And noise corrupts the signal. That is why such care is taken to eliminate noise from a communication channel..

So what we are seeing in these two examples are features of operations we would expect in genetic engineering design. As James Shipiro describes it Natural Genetic Engineering.

Please reflect on his concluding submission entitled
A 21st Century View of Evolution.

In part he states

The last half century has taught us an astonishing amount about how living organisms function at the molecular level, in particular about how they execute cellular computations through molecular interactions and about the systemic, modular, computation-ready organization of the genome. We have come to realize some of the basic design features that govern genome structure. Combining this knowledge with our understanding of how natural genetic engineering operates, it is possible to formulate the outlines of a new 21st Century vision of evolutionary engineering that postulates a more regular principle-based process of change than the gradual random walk of 19th and 20th Century theories. Such a new vision is not all-encompassing because it cannot provide detailed accounts for major events currently beyond the reach of science, such as the origin of cellular life or the mechanisms of endosymbiotic events underlying the emergence of distinct superkingdoms and kingdoms of life (51, 52). Nonetheless, a 21st Century view of evolution can help us understand how new taxonomic groups have emerged bearing novel complex adaptations.
scottie
Coral
Coral
 
Posts: 214
Joined: Tue Apr 12, 2011 9:41 pm

Postby BDDVM » Fri May 20, 2011 11:56 pm

And your point is.....
BDDVM
Death Adder
Death Adder
 
Posts: 76
Joined: Sat Nov 13, 2010 3:24 am

Re: Theories - Origin of Life

Postby scottie » Mon May 23, 2011 8:28 pm

Canalon
And will you make any progress toward answering the question?

"If design cannot be spontaneous, where/how did the designer originate?"
Patrick


This question is very confusing.

Where have I stated that design cannot be spontaneous?

May I remind what your original question was.
But if you provide a reasonned and undestandable model for design, I promise that I will definitely reconsider my views on evolution.


This is what I am in the progress of dealing with. So I will continue.

Now I deliberately waited a while before continuing in the hope that you would read the papers I have cited.

IF you have then you will know the answer to the question raised. However for the sake of clarity in case you have not fully absorbed the information I have presented.
Allow me to quote directly from his (Shapiro's)paper that incidentally has referenced some 56 other papers and articles in support of his presentation.
Here is the paper again
http://shapiro.bsd.uchicago.edu/21st_Ce ... _Evol.html

Under the heading
A 21ST CENTURY VIEW OF EVOLUTION

"The last half century has taught us an astonishing amount about how living organisms function at the molecular level, in particular about how they execute cellular computations through molecular interactions and about the systemic, modular, computation-ready organization of the genome. We have come to realize some of the basic design features that govern genome structure.
Combining this knowledge with our understanding of how natural genetic engineering operates, it is possible to formulate the outlines of a new 21st Century vision of evolutionary engineering that postulates a more regular principle-based process of change than the gradual random walk of 19th and 20th Century theories.

Such a new vision is not all-encompassing because it cannot provide detailed accounts for major events currently beyond the reach of science, such as the origin of cellular life or the mechanisms of endosymbiotic events underlying the emergence of distinct superkingdoms and kingdoms of life (51, 52).

Nonetheless, a 21st Century view of evolution can help us understand how new taxonomic groups have emerged bearing novel complex adaptations."

He then summarises in the following way

"� Major evolutionary change to the genome occurs by the amplification and rearrangement of pre-existing modules. Old genomic systems are disassembled and new genomic systems are assembled by natural genetic engineering functions that operate via non-random molecular processes.

� Major alterations in the content and distribution of repetitive DNA elements results in a reformatting of the genome to function in novel ways --without major alterations of protein coding sequences. These reformattings would be particularly important in adaptive radiations within taxonomic groups that use the same basic materials to make a wide variety of morphologically distinct species (e.g. birds and mammals).

Large-scale genome-wide reorganizations occur rapidly (potentially within a single generation) following activation of natural genetic engineering systems in response to a major evolutionary challenge. The cellular regulation of natural genetic engineering automatically imposes a punctuated tempo on the process of evolutionary change.

� Targeting of natural genetic engineering processes by cellular control networks to particular regions of the genome enhances the probability of generating useful new multi-locus systems. (Exactly how far the computational capacity of cells can influence complex genome rearrangements needs to be investigated. This area also holds promise for powerful new biotechnologies.)

� Natural selection following genome reorganization eliminates the misfits whose new genetic structures are non-functional. In this sense, natural selection plays an essentially negative role, as postulated by many early thinkers about evolution (e.g. 53). Once organisms with functional new genomes appear, however, natural selection may play a positive role in fine-tuning novel genetic systems by the kind of micro-evolutionary processes currently studied in the laboratory."

He concludes this way

"Molecular genetics has amply confirmed McClintock�s discovery that living organisms actively reorganize their genomes (5). It has also supported her view that the genome can "sense danger" and respond accordingly (56).
The recognition of the fundamentally biological nature of genetic change and of cellular potentials for information processing frees our thinking about evolution. In particular, our conceptual formulations are no longer dependent on the operation of stochastic processes. Thus, we can now envision a role for computational inputs and adaptive feedbacks into the evolution of life as a complex system. Indeed, it is possible that we will eventually see such information-processing capabilities as essential to life itself."

In 2009 Shapiro revisited this subject and you will find his paper here.
http://shapiro.bsd.uchicago.edu/Shapiro ... 0Dogma.pdf
This time citing 154 reference articles.
Under
Natural Genetic Engineering
Underlying the central dogma and conventional views of genome evolution was the ideathat the genome is a stable structure thatchanges rarely and accidentally by chemicalfluctuations or replication errors. This view has had to change with the realization that maintenance of genome stability is an active cellular function and the discovery of numerous dedicated biochemical systems for restructuring DNA molecules.

Genetic changeis almost always the result of cellular action on the genome. These natural processes are analogous to human genetic engineering, and their
activity in genome evolution has been extensively documented.


In summary therefore
The mechanism for genetic change is the natural genetic engineering process Shapiro describes.
Old genomic systems are disassembled and new genomic systems are assembled by natural genetic engineering functions that operate via non-random molecular processes.
Basic design features are now recognised
Major change occurs suddenly (potentially within one generation and supported by the fossil record)

You will notice that although Shapiro acknowledges the design engineering process. He also states that it’s origin is currently beyond the scope of science.

If you want to persist in your argument of having to name or describe a designer, for the process to be credible, then your argument against the evolutionary community itself.
Because Shapiro is an evolutionary biologist and so are a great number of scientists who also recognise this process.

There are a reducing number of biologists who still subscribe to the Darwinian process of random mutations.
The main protagonists are notably Dawkins and Coyne who seem more interested in promoting their religious views rather than science.
scottie
Coral
Coral
 
Posts: 214
Joined: Tue Apr 12, 2011 9:41 pm

PreviousNext

Return to Evolution

Who is online

Users browsing this forum: No registered users and 4 guests