Login

Join for Free!
61170 members
table of contents table of contents

In this report, by inclusion of multiple components of the HIV genome, …


');

Biology Articles » Virology » Rev-dependent lentiviral expression vector » Methods

Methods
- Rev-dependent lentiviral expression vector

Viruses and cells

Viruses and cells were obtained through the NIH AIDS Research and Reference Reagent Program: pNL4-3.HSA.R+E- from Dr. Nathaniel Landau [29]; CEM-SS from Dr. Peter L. Nara [37]; J1.1 cells from Dr. Thomas Folks [38]. HIV-1AD8 is a macrophage-tropic molecular clone [39]. Macrophages were derived from peripheral blood monocytes of healthy donors from the Department of Transfusion Medicine at the National Institutes of Health. Cells were cultured in RPMI media supplemented with 10% fetal bovine serum (Hyclone) and recombinant human macrophage colony stimulating factor (rH-MCSF) (R & D Systems) at 10 ng/ml. Media was changed every 48 hours for ten days.

DNA constructs

pCMVΔR8.2 and pMD.G have been described previously [28]. pNL-GFP-RRE was constructed by complete deletion of all HIV ORFs of pNL4-3 [40] by replacing the 8.1 kb BssHII-BlpI fragment of the HIV-1 genomes with an insert containing the GFP ORF and the HIV-1 Rev-responsive element (RRE) including the HIV-1 sequence immediately following the BssHII site and the first 336 nucleotides of the gag ORF (the gag reading frame was disrupted by a frame shift mutation at the ClaI site by blunt end ligation), the GFP ORF was derived from pIRES-hrGFP-1a (Stratagene) by PCR amplification (5' CTCGAAATTAACCCTCACTAAAGG 3'; 5'ATCGTGTACGGCCGAATTGGGTACACTTACCTG 3'), and the fragment containing RRE (corresponding to position 7612 to 8469 of the HIV-1NL4-3 genome). pNL-GFP-RRE-(SA) was constructed by insertion of a PCR fragment into the NotI-SmaI site of pNL-GFP-RRE, in front of the GFP ORF. The insert carrying the HIV-1 A5 splicing acceptor and D4 donor was amplified by primers: 5' ATAAGAATGCGGCCGCATCTCCTATGGCAGGAAG 3'; 5' AATCACCCGGGTGCTACTACTAATGCTACTATTGC 3'. The sequence of pNL-GFP-RRE-(SA) has been deposited in GenBank (accession number EF408805).

Virus generation

Stocks of the HIV-1NL4-3 and HIV-1AD8 were prepared by transfection of HeLa cells with cloned proviral DNA. HIV-1 based lentiviral vectors carrying reporter genes were made by cotransfection of DNA constructs as follows: 2 × 106 293T cells were cotransfected with 10 ug of pNL-GFP-RRE-SA, 7.5 ug of pCMVΔR8.2, and 2.5 ug of pMD.G using the calcium phosphate method (Promega). Viral particles were harvested 2 days after cotransfection and filtered through a 0.45 um filter and stored at -80°. One preparation was concentrated by ultracentrifugation [41]. The titer (TCID50) of the lentiviral indicator vNL-GFP-RRE(SA) virus preparation was estimated by serial dilution into activated (TNF-treated) HIV-positive J1.1 Jurkat cells [38] following the method of Reed and Muench [42].

RT-PCR analysis

Total cellular poly(A+) mRNA was purified from cells by MicroPoly(A)Pure mRNA isolation kit (Ambion) as recommended by the manufacturer. Reverse transcription was accomplished using the RETROscript First-Strand Synthesis Kit (Ambion) with random decamers as the first-strand primers. Following cDNA synthesis, PCR was carried out using primer 5'TAATCGGCCGAACAGGGACTTGAAAGCGAAAG3' and 5'CAGGCACAAGCAGCATTGTTAG 3' to amplify spliced lentiviral transcripts, and primer 5' TAATCGGCCGAACAGGGACTTGAAAGCGAAAG3' and 5'ATCGTGTACGGCCGAATTGGGTACACTTACCTG3' to amplify non-spliced GFP transcripts. The PCR condition was: 1 × PCR buffer, 125 uM dNTPs, 1.5 mM Mg2+, 50 pmol of each primer, 1 U SuperTaq Plus (Ambion) in 50 ul, with 30 cycles of 20 sec at 94°, and 180 sec at 68°. One fifth of the product was analyzed on 2% agarose gel. Cellular β-actin transcripts were amplified using QuantumRNA β-actin Internal Standards (Ambion) with similar conditions as above except using 20 pmol of each actin primer and runs at 20 sec at 94°, 30 sec at 55°, and 40 sec at 68°.

Reporter virus detection of HIV infection

CEM-SS cells, infected with VSV pseudo-typed HIV-1 NL4-3.HSA.R+E- [29], were enriched by biotin conjugated rat-anti-mouse CD24 antibody and streptavidin conjugated magnetic beads and further cultured for two weeks to remove the beads. The enriched population was then infected with the Rev-dependent lentiviral vector, vNL-GFP-RRE(SA). At 72 hrs post transduction, cells were stained with R-phycoerythrin conjugated rat-anti-mouse CD24 antibody and analyzed by flow cytometer for CD24 and GPF expression. Curve fitting and statistical analysis were achieved with GraphPad Prism software.

Monocyte-derived macrophages in six well plates were infected with HIVAD8 (36 to 360 ng p24) in 500 ul of RPMI for 3 hours, then washed and returned to 2 ml RPMI. The following day, 5 ng p24 of pNL-GFP-RRE(SA) was applied to the macrophages. At 5 days post infection, cells were intracellularly stained on ice. Briefly, cells were rinsed once with Hank's buffer followed by treatment with Cytofix/Cytoperm (Becton Dickinson) for 20 min, then 2 ml of cold methanol for 15 min. After washing with Permeabilization/Wash buffer (Becton Dickinson), cells were stained with anti-p24 HIV antibody 183.H12-5C (1:250) [43-45] for 90 min, followed by washing and staining with Alexa Fluor-568 goat anti-mouse IgG (Invitrogen) (1:250) for 30 minutes.

Fluorescent microscopy of monocyte-derived macrophages

The GFP-expressing and anti-p24 stained cells were photographed using a Leica DMIRB/E inverted research microscope attached to a Orca DCAM ER camera (Hamamtsu), using an XF102.2 filter (Omega Optical Inc.) for the Alexa Fluor-568 (p24) detection and a GFP filter (Leica) for the GFP expressing cells. P24 expression and GFP expression were captured with similar exposures, typically 1000 milliseconds. Files were saved as Tiffs and color was added on ImageJ software version 1.33u (Rasband, W., NIH-public domain). Dimensions were determined through a stage micrometer (Electron Microscopy Sciences).

Flow cytometry

Infected or uninfected cells were re-suspended into 100 ul Hank's staining buffer (Hank's buffer plus 0.1% bovine serum albumin, 0.1% sodium azide, and 25 mM HEPES, pH 7.2) for staining with antibodies at concentrations recommended by manufactures. Following staining for 30 min on ice, cells were either washed with Hank's buffer or, in the case of HIV-infected cells, fixed with 500 ul of Cytofix/Cytoperm (Becton Dickenson) for 20 min on ice for flow cytometry analysis on a FACScan analyzer (Becton Dickenson). The murine CD24 antibody was from Southern Biotechnology.


rating: 1.00 from 1 votes | updated on: 8 May 2008 | views: 7133 |

Rate article:







excellent!bad…