Login

Join for Free!
118255 members
table of contents table of contents

The multicellular alga Volvox carteri possesses only two cell types: mortal, motile …


Biology Articles » Protistology » Phycology » Quantitative analysis of cell-type specific gene expression in the green alga Volvox carteri » Tables

Tables
- Quantitative analysis of cell-type specific gene expression in the green alga Volvox carteri

 

Table 1

List of 39 Volvox genes and gene products, including subset classification, comparisons with homologs in other species, and significance of the sequence relationship to these homologs.

Subset V. carteri gene(• novel Volvox gene) V. carteri gene product Significance: percent identity with characterized homolog (# of identical residues/total # of residues)[similarity] Gene product and species name of characterized homolog used for sequence comparison
A actA actin[11] [GenBank:M33963] 98.0 % (370/377)[99.0 % (375/377)] actin Chlamydomonas reinhardtii [55] [GenBank:D50839]
A ssgA pherophorin-like ECM-glycoprotein SSG185 [15] [GenBank:X51616] 54.4 % (137/252)[85.3 % (215/252)] pherophorin-C3 Chlamydomonas reinhardtii [13] [GenBank:DQ196109]
A regA somatic regenerator RegA [9] [GenBank:AF106963] 67.5 % (81/120)[91.7 % (110/120)] RegA-like sequence protein RlsA [9, 16] [GenBank:AF106962]
A gon30 G30 protein [6, 56] [GenBank:AF110790] 85.4 % (380/445)[91.2 % (406/445)] low-CO2 inducible protein LciC Chlamydomonas reinhardtii [43, 44] [GenBank:AB168094]
A gon167 G167 protein [6] [GenBank:U31955] 99.1 % (210/212)[99.5 % (211/212)] recombinase (ORF-C) on retrotransposon kangaroo-1 Volvox carteri [57] [GenBank:AY137241]
B rlsA RegA-like sequence protein RlsA [9, 16] [GenBank:AF106962] 67.5 % (81/120)[91.7 % (110/120)] somatic regenerator RegA [9] [GenBank:AF106963]
C csrp1 chloroplast-specific ribosomal protein [GenBank:AY835992] 36.7 % (79/215)[76.3 % (164/215)] chloroplast-specific ribosomal protein PSrp-1, 30S subunit Spinacia oleracea [58] [GenBank:M55322]
C ard1 C2H2-type zinc finger related protein with arsenite-resistance domain [GenBank:AY850006] 43.0 % (16/37)[62.0 % (23/37)] RING finger protein 13 RNF13 Gallus gallus [GenBank:AY787020]
C mrp2 ATP-energized ABC transporter Mrp2 [GenBank:AY835993] 91.4 % (243/266)[99.6 % (265/266)] ABC transporter Mrp1 Chlamydomonas reinhardtii [59] [GenBank:AF442557]
C gspk47 gonidia-specific protein KA_k47 [GenBank:AY835994] --- ---
D nitA nitrate reductase NitA [19] [GenBank:X64136] 80.8 % (698/864)[96.1 % (830/864)] nitrate reductase Nit1 Chlamydomonas reinhardtii [60] [GenBank:AF203033]
E dyhA flagellar α dynein (heavy chain) [GenBank: EF123072] 93.6 % (132/141)[97.8 % (138/141)] flagellar α dynein (heavy chain) ODA11 Chlamydomonas reinhardtii [21, 22] [GenBank:L26049]
E klpA kinesin-like protein [GenBank: EF123073] 84.8 % (117/138)[98.5 % (136/138)] kinesin-like protein FLA10 Chlamydomonas reinhardtii [23] [GenBank:L33697]
E fer1 ferredoxin Fer1 [GenBank: EF123074] 74.2 % (95/128)[93.7 % (120/128)] ferredoxin PETF (chloroplast) Chlamydomonas reinhardtii [61] [GenBank:L10349]
E nab1 nucleic acid binding protein Nab1 [GenBank: EF123075] 87.8 % (216/247)[97.1 % (239/247)] nucleic acid binding protein Nab1 Chlamydomonas reinhardtii [25] [GenBank:AY157846]
E rap41 ribosome-associated protein (chloroplast-specific) [GenBank: EF123076] 55.0 % (60/109)[89.9 % (98/109)] ribosome-associated protein Rap41 (chloroplast-specific) Chlamydomonas reinhardtii [26] [GenBank:AY177616]
E fbp1 chloroplast fructose-1,6-bisphosphatase [GenBank:EF123077] 61.1 % (196/318)[86.4 % (275/318)] chloroplast fructose-1,6-bisphosphatase FBP Brassica napus [27] [GenBank:L15303]
E cp12 Calvin cycle protein CP12 [GenBank: EF123078] 78.6 % (81/103)[97.1 % (100/103)] Calvin cycle protein CP12 Chlamydomonas reinhardtii [28] [GenBank:AJ005284]
F prfA profilin PrfA [GenBank: EF123079] 59.5 % (78/131)[90.8 % (119/131)] profilin PRF1 Chlamydomonas reinhardtii [30] [GenBank:AF335423]
F fsd1 superoxide dismutase Fsd1 [GenBank: EF123080] 88.7 % (204/230)[98.7 % (227/230)] superoxide dismutase FSD1 Chlamydomonas reinhardtii [31] [GenBank:U22416]
F rpl37 ribosomal protein L37 [GenBank: EF123081] 59.8 % (58/97)[87.6 % (85/97)] ribosomal protein L37 (RPL37) Homo sapiens [32] [GenBank:NM_000997]
F glu1 glutamate synthase [GenBank: EF123082] 68.4 % (575/841)[92.4 % (777/841)] glutamate synthase GltB Spinacia oleracea [33] [GenBank:AF061515]
F hsp70B heat shock protein 70 B [GenBank: EF123083] 70.9 % (141/199)[94.5 % (188/199)] heat shock protein 70 Hsc70-7 Arabidopsis thaliana [34] [GenBank: AF217459]
F hsp40A hsp40-like heat shock protein [GenBank: EF123084] 34.0 % (34/100)[70.0 % (70/100)] heat-shock protein HSJ1 (DnaJ-like) Homo sapiens [35] [GenBank:NM_001039550]
F ubcA ubiquitin conjugating enzyme E2 [GenBank: EF123085] 77.9 % (116/149)[94.0 % (140/149)] ubiquitin conjugating enzyme E2 (UBC14) gene Arabidopsis thaliana [36] [GenBank:U33759]
F ponA pontin [GenBank: EF123086] 76.7 % (345/450)[95.3 % (429/450)] Pontin52 Homo sapiens [37] [GenBank: AF099084]
F mat3 retinoblastoma-like protein Mat3 [GenBank: EF123087] 73.6 % (162/220)[92.3 % (203/220)] retinoblastoma-like protein Mat3 Chlamydomonas reinhardtii [38] [GenBank: AF375824]
F vpeA vacuolar processing enzyme VPE [GenBank: EF123088] 61.0 % (61/100)[86.0 % (86/100)] vacuolar processing enzyme VPE-2 Nicotiana tabacum [39] [GenBank:AB075949]
F sac1 sulfur deprivation response regulator Sac1 [GenBank: EF123089] 87.1 % (242/278)[98.6 % (274/278)] sulfur deprivation response regulator Sac1 Chlamydomonas reinhardtii [40] [GenBank: U47541]
F rcd1 required-for-cell-differentiation 1 protein Rcd1 [GenBank: EF123090] 69.5 % (196/282)[90.1 % (254/282)] required-for-cell-differentiation 1 protein Rcd1 Homo sapiens [42] [GenBank:NM_005444]
F adcA adenylate cyclase [GenBank:EF123091] 63.6 % (98/154)[86.4 % (133/154)] adenylate cyclase, type II ADCY28 Chlamydomonas reinhardtii (JGI Chlamydomonas ID 121064)
F nipA NaCl-inducible protein [GenBank: EF123092] 58.3 % (49/84)[86.9 % (73/84)] NaCl-inducible protein (NIP) Chlamydomonas reinhardtii [GenBank:AU066522]
F lciB low-CO2 inducible protein LciB [GenBank:EF123093] 56.3 % (190/339)[87.4 % (396/339)] low-CO2 inducible protein LciB Chlamydomonas reinhardtii [43, 44] [GenBank:AB168093]
G upf1 protein of unknown function [GenBank: EF123094] --- ---
G upf2 protein of unknown function [GenBank:EF123095] --- ---
G upf3 protein of unknown function [GenBank: EF123096] --- ---
G upf4 protein of unknown function [GenBank: EF123097] --- ---
G upf5 protein of unknown function [GenBank: EF123098] --- ---
G upf6 protein of unknown function [GenBank: EF123099] --- ---

Nematollahi et al. BMC Genomics 2006 7:321   doi:10.1186/1471-2164-7-321

Table 2

Primers used for quantitative real-time RT-PCR and lengths of cDNA and gDNA products.

Name Forward Primer (5'→3') Reverse Primer (5'→3') Product lengthcDNA Product lengthgDNA
actA TGAGAAGACGTACGAGCTGC CCTCCATGCCGATTAGGCTA 104 241
ssgA TTCGCATCGTGAAGGACCTT CCGTTAACGTCCATGAACAG 130 780
regA CAATGGCAGCAAATGGATGTC GTTCCAAATCAGGCAACACG 101 1339
gon30 CCATGTTTGTGTCCTCTCCA GGTTATCGAGGCAGGCATTA 106 106
gon167 GCTTCTATCGTTTGCGGAAG GCACGCATACAACCTACAC 112 112
rlsA CACAATGGCAGCAAATGGATG GGTTCCAAATCAGGCAACAC 104 1445
csrp1 TGTGTGACTCCTGCAAGCA TGGATGATGATGCGAACGG 149 266
ard1 TGGCTAGGCCATATCCTTTG TCGATGGTGTTCCTACGTGA 144 144
mrp2 GTGGTTCGTTTCATCGCTG TGCATCCAGACATCCTCGA 125 519
gspk47 ATTCGACAAGGTGGACAAGG GGTCTTGACAGGGATAGGA 116 116
nitA CCACGAGCACTACCTACTG CCGGAAGCACACGAAGTTG 101 584
dyhA AACGCTGTCGTGGAGTTCAT TTCGGGGTCGTGTAGTTGT 101 302
klpA GCCACCAAGATTAACCTGTC CGCACATGATTGTCTTCGTG 151 908
fer1 ATGGACCTGCCGTACTCTTG GCCTCCATCTGCTTATCGTC 116 116
nab1 GGAACCGTGAAGTGGTTCAAC CCTCAACCTCAAACTCGACG 122 498
rap41 TCTCCACAAGGCTCTAGTTG GTGTAGATGGTCGCGATATC 123 123
fbp1 GGTGAGGACCAGAAGAAGC GAGTAGGTCTCCTCCACAG 131 453
cp12 AAGTACTGCCAGGACGCTC GCTCGTCGTGACGCAGTAA 129 289
prfA ACGCCTGAAGAGTTCGAGA GCAGAACAGTCTCGTCAGA 112 112
fsd1 AGATCGTCCTGGCTAGCTG CACCATTTGCCTTCATGCTTTC 146 146
rpl37 ACCAGCTACCACAACCAGAA AAGCGTCTTCATGTACCGCA 138 345
glu1 AGGCTATGACTAAGCTCGAG ATCGCCTTATGCAGCAGCTT 103 295
hsp70B AGGTCTTTTCCACTGCTGCC TCAATTTGTGGAACTCCACGCG 148 454
hsp40A GCCAGGGATGATGTTCAACT TTAACGATGCGTGCACTCCT 130 130
ubcA GGTTTCTTCAACGCAAAGCTA ATGGAGGATGGAAATGCAGA 129 198
ponA AAGAAGACGGAGATCACGGA GTGAAGCACTCGATATCCAG 140 1029
mat3 GCAGATAGTGCTTAAGCTTGG CGTGACTAACGAGGATGGC 128 274
vpeA CACTGGGCTCTGCTAGTAG CTATGTCGTCGTACATCATGAC 139 560
sac1 GTCACCGGTGTACTTACCGTA CATCCACTTGAAGCAGCTCA 155 633
rcd1 GTGCGTGGCGTCTCACAATG CAACCGCAGGTACTCGAAGG 118 260
adcA GTGCCATATGTCGGATTTCTG CATGACGATCACGACGTTTC 144 144
nipA GGGTGAGAAAGCGATTGAAG TTGTCCGCAATGTCCGACT 102 373
lciB CCGTCGACGACTTTATCTCC AGACTCATCTCGGCACAGGT 101 438
upf1 CTTTGAGCTGCTGCAACACC GGAGCGTGTGACCTACTG 152 914
upf2 GTTGCCGCCATGGATTTCC GGTTGTTAAGCGCAACACGTA 113 113
upf3 CGTTATGGCTGCATATCACC ACATTTCATAACCGAACAACACCAC 108 108
upf4 AAATTGCATCGCTGCAAGCG AAAACCGGCAAGTGTCACTC 133 133
upf5 CAGTTAACGGCTCAACATTGG CATGCACGTAAGCTTTCTTCC 128 128
upf6 TGCACGAGAGCTGTTGGTT CACGCCTTAGTGCGAATATC 135 135

Nematollahi et al. BMC Genomics 2006 7:321   doi:10.1186/1471-2164-7-321

Table 3

Results of real-time RT-PCR experiments. Standard deviations are given in parentheses.

mDNA ΔCt gonidia ΔCt somatic cells ΔΔCt 2-ΔΔCt or 1/2-ΔΔCt ×-fold higher expression in
ssgA 5.94 (± 0.7) 0.42 (± 0.2) 5.52 (± 0.8) 45.97 × somatic cells
regA 11.27 (± 0.3) 4.04 (± 0.2) 7.23 (± 0.2) 149.72 × somatic cells
gon30 2.04 (± 0.5) -0.69 (± 0.5) 2.73 (± 0.3) 6.62 × somatic cells
gon167 -1.62 (± 0.2) 0.92 (± 0.3) -2.54 (± 0.2) 5.82 × gonidia
rlsA 11.17 (± 0.8) 5.06 (± 0.5) 6.12 (± 0.4) 69.32 × somatic cells
csrp1 2.36 (± 1.7) 0.46 (± 0.2) 1.90 (± 2.0) 3.74 × somatic cells
ard1 7.65 (± 0.6) 8.84 (± 0.8) -1.18 (± 1.4) 2.27 × gonidia
mrp2 2.49 (± 0.1) -1.55 (± 0.7) 4.04 (± 0.6) 16.45 × somatic cells
gspk47 4.59 (± 0.3) 5.40 (± 0.2) -0.81 (± 0.4) 1.75 × gonidia
nitA 8.27 (± 0.3) 7.82 (± 0.6) 0.45 (± 0.3) 1.36 × somatic cells
dyhA 5.71 (± 0.2) -1.61 (± 0.2) 7.32 (± 0.4) 159.82 × somatic cells
klpA 4.29 (± 0.6) -0.13 (± 0.4) 4.42 (± 0.2) 21.42 × somatic cells
fer1 1.52 (± 0.0) 4.47 (± 0.3) -2.95 (± 0.2) 7.73 × gonidia
nab1 2.08 (± 0.4) 4.14 (± 0.0) -2.06 (± 0.1) 4.17 × gonidia
rap41 3.58 (± 0.0) 5.92 (± 0.4) -2.33 (± 0.4) 5.04 × gonidia
fbp1 -0.33 (± 0.4) 0.31 (± 0.2) -0.64 (± 0.5) 1.56 × gonidia
cp12 -0.82 (± 0.2) 1.18 (± 0.2) -1.99 (± 0.1) 3.98 × gonidia
prfA 1.23 (± 0.5) 3.63 (± 0.1) -2.40 (± 0.4) 5.29 × gonidia
fsd1 2.07 (± 0.2) 3.78 (± 0.4) -1.71 (± 0.5) 3.27 × gonidia
rpl37 -0.68 (± 0.5) 2.21 (± 0.0) -2.89 (± 0.5) 7.43 × gonidia
glu1 3.49 (± 0.2) 2.70 (± 0.2) 0.79 (± 0.3) 1.73 × somatic cells
hsp70B 0.12 (± 0.3) 0.54 (± 0.0) -0.43 (± 0.4) 1.34 × gonidia
hsp40A 3.24 (± 0.4) 0.54 (± 0.3) 2.70 (± 0.2) 6.50 × somatic cells
ubcA 5.84 (± 0.0) 3.69 (± 0.1) 2.15 (± 0.0) 4.44 × somatic cells
ponA 5.22 (± 0.5) 4.31 (± 0.2) 0.91 (± 0.3) 1.88 × somatic cells
mat3 2.31 (± 0.1) -0.87 (± 0.2) 3.18 (± 0.1) 9.03 × somatic cells
vpeA 3.84 (± 0.2) 3.20 (± 0.5) 0.64 (± 0.3) 1.56 × somatic cells
sac1 6.88 (± 0.1) 5.84 (± 0.1) 1.03 (± 0.2) 2.04 × somatic cells
rcd1 1.70 (± 0.6) 4.08 (± 0.1) -2.38 (± 0.7) 5.22 × gonidia
adcA 6.23 (± 0.3) 1.76 (± 0.6) 4.47 (± 0.4) 22.18 × somatic cells
nipA -0.45 (± 0.1) -2.21 (± 0.4) 1.76 (± 0.4) 3.39 × somatic cells
lciB 1.68 (± 0.5) -0.46 (± 0.6) 2.14 (± 0.1) 4.40 × somatic cells
upf1 7.44 (± 0.4) 6.51 (± 0.2) 0.93 (± 0.6) 1.90 × somatic cells
upf2 1.69 (± 0.1) 2.16 (± 0.2) -0.47 (± 0.3) 1.39 × gonidia
upf3 2.14 (± 0.4) 1.50 (± 0.1) 0.64 (± 0.6) 1.55 × somatic cells
upf4 12.50 (± 0.2) 14.64 (± 0.7) -2.14 (± 0.9) 4.41 × gonidia
upf5 -3.35 (± 0.1) -4.67 (± 0.1) 1.32 (± 0.2) 2.49 × somatic cells
upf6 -0.74 (± 0.4) -3.51 (± 0.1) 2.76 (± 0.3) 6.78 × somatic cells

Nematollahi et al. BMC Genomics 2006 7:321   doi:10.1186/1471-2164-7-321


rating: 3.00 from 2 votes | updated on: 26 Sep 2007 | views: 7658 |

Rate article:







excellent!bad…