Login

Join for Free!
114673 members
table of contents table of contents

A genome-comparison strategy to identifying nuclear gene markers for phylogenetic inference and …


Biology Articles » Zoology » Ichthyology » A practical approach to phylogenomics: the phylogeny of ray-finned fish (Actinopterygii) as a case study » Table 1

Table 1
- A practical approach to phylogenomics: the phylogeny of ray-finned fish (Actinopterygii) as a case study

Table 1

PCR primers and annealing temperatures used to amplify 10 new markers

Gene*
Primers
Sequences
Annealing temp
PCR steps

zic1
zic1_F9
5' GGACGCAGGACCGCARTAYC 3'
57
1st
  zic1_R967
5' CTGTGTGTGTCCTTTTGTGRATYTT 3'
  PCR
  zic1_F16
5' GGACCGCAGTATCCCACYMT 3'
57
2nd
  zic1_R963
5' GTGTGTCCTTTTGTGAATTTTYAGRT 3'
  PCR
myh6
myh6_F459
5' CATMTTYTCCATCTCAGATAATGC 3'
53
1st
  myh6_R1325
5' ATTCTCACCACCATCCAGTTGAA 3'
  PCR
  myh6_F507
5' GGAGAATCARTCKGTGCTCATCA 3'
62
2nd
  myh6_R1322
5' CTCACCACCATCCAGTTGAACAT 3'
  PCR
RYR3
RYR3_F15
5' GGAACTATYGGTAAGCARATGG 3'
55
1st
  RYR3_R968
5' TGGAAGAAKCCAAAKATGATGC 3'
  PCR
  RYR3_F22
5' TCGGTAAGCARATGGTGGACA 3'
62
2nd
  RYR3_R931
5' AGAATCCRGTGAAGAGCATCCA 3'
  PCR
Ptr
Ptr_F458
5' AGAATGGATWACCAACACYTACG 3'
55
1st
  Ptr_R1248
5' TAAGGCACAGGATTGAGATGCT 3'
  PCR
  Ptr_F463
5' GGATAACCAACACYTACGTCAA 3'
62
2nd
  Ptr_R1242
5' ACAGGATTGAGATGCTGTCCA 3'
  PCR
tbr1
tbr1_F1
5' TGTCTACACAGGCTGCGACAT 3'
57
1st
  tbr1_R820
5' GATGTCCTTRGWGCAGTTTTT 3'
  PCR
  tbr1_F86
5' GCCATGMCTGGYTCTTTCCT 3'
62
2nd
  tbr1_R811
5' GGAGCAGTTTTTCTCRCATTC 3'
  PCR
ENC1
ENC1_F85
5' GACATGCTGGAGTTTCAGGA 3'
53
1st
  ENC1_R982
5' ACTTGTTRGCMACTGGGTCAAA 3'
  PCR
  ENC1_F88
5' ATGCTGGAGTTTCAGGACAT 3'
62
2nd
  ENC1_R975
5' AGCMACTGGGTCAAACTGCTC 3'
  PCR
Gylt
Glyt_F559
5' GGACTGTCMAAGATGACCACMT 3'
55
1st
  Glyt_R1562
5' CCCAAGAGGTTCTTGTTRAAGAT 3'
  PCR
  Glyt_F577
5' ACATGGTACCAGTATGGCTTTGT 3'
62
2nd
  Glyt_R1464
5' GTAAGGCATATASGTGTTCTCTCC 3'
  PCR
SH3PX3
SH3PX3_F461
5' GTATGGTSGGCAGGAACYTGAA 3'
55
1st
  SH3PX3_R1303
5' CAAACAKCTCYCCGATGTTCTC 3'
  PCR
  SH3PX3_F532
5' GACGTTCCCATGATGGCWAAAAT 3'
62
2nd
  SH3PX3_R1299
5' CATCTCYCCGATGTTCTCGTA 3'
  PCR
plagl2
plagl2_F9
5' CCACACACTCYCCACAGAA 3'
55
1st
  plagl2_R930
5' TTCTCAAGCAGGTATGAGGTAGA 3'
  PCR
  plagl2_F51
5' AAAAGATGTTTCACCGMAAAGA 3'
62
2nd
  plagl2_R920
5' GGTATGAGGTAGATCCSAGCTG 3'
  PCR
sreb2
sreb2_F10
5' ATGGCGAACTAYAGCCATGC 3'
55
1st
  sreb2_R1094
5' CTGGATTTTCTGCAGTASAGGAG 3'
  PCR
  sreb2_F27
5' TGCAGGGGACCACAMCAT 3'
62
2nd
  sreb2_R1082
5' CAGTASAGGAGCGTGGTGCT 3'
  PCR

*Gene markers are named following annotations in ENSEMBLE. zic1, zic family member 1; myh6, myosin, heavy polypeptide 6; RYR3 (si:ch211-189g6.1), novel protein similar to vertebrate ryanodine receptor 3; Ptr (si:ch211-105n9.1), hypothetical protein LOC564097; tbr1, T-box brain 1; ENC1(559445 Entrezgene), similar to ectodermal-neural cortex 1; Glyt (zgc:112079), glycosyltransferase; SH3PX3, similar to SH3 and PX domain containing 3 gene; plagl2, pleiomorphic adenoma gene-like 2; sreb2, Super conserved receptor expressed in brain 2.


rating: 0.00 from 0 votes | updated on: 2 Jul 2008 | views: 4238 |

Rate article:







excellent!bad…