Login

Join for Free!
122498 members
Advertisement
Advertisement

table of contents table of contents

A study showing that export factors are recruited to the sites of …


Home » Biology Articles » Molecular Biology » Messenger RNAs are recruited for nuclear export during transcription » Materials and methods

Materials and methods
- Messenger RNAs are recruited for nuclear export during transcription

Yeast strains and genetic manipulations

Standard yeast methods and media were utilized (Guthrie and Fink 1991). Strains used in this study: FY23/PSY580 MATa ura3-52 trp163 leu21; PSY603 MATa his3 ade2 can1 leu2 lys1 ura3 ade8; PSY 1031 MATalphanpl3-27 ura3-52 leu2-3,112 his3 lys1-1 trp1-1 ade2-1 ade8 can1-100; PSY 1032 MATa npl3-27 ura3-52 leu2-3,112 his3 lys1-1 ade2-1 ade8 can1-100; PSY 1698 MATalphanpl3-27 spt15-ts1 ura3-52 leu2-3,112 his3 lys1-1 ade2-1 ade8 can1-100; PSY 1699 MATa npl3-27 spt15-ts1 ade2-1 can1-100 his3 leu2-3,112 lys1-1 ura3-52 ade8; PSY 1702 MATalphaspt15-ts1 ade2-1 ura3-52 leu2-3,112 his3 lys1-1 trp1-1 ade8 can1-100; PSY 1703 MATalphaspt15-ts1 ade2-1 can1-100 his3 leu2-3,112 lys1-1 ura3-52 ade8; YRA1-MYC is identical to YRA1 shuffle MATa ade2 his3 leu2 trp1 ura3 yra1::HIS3 (Sträßer and Hurt 2000) but contains the plasmid pNOPMYCA1L-YRA1, which was constructed by cloning the entire ORF of YRA1 from pNOPPATA1L-YRA1 into the PstI site of pNOPMYCA1L (K. Straesser and E. Hurt, unpubl.). Strains were provided generously by F. Winston, Harvard Medical School (spt15-328, spt15-341), R. Young, Whitehead Institute for Biomedical Research (rpb1-1, CTD truncations), and E. Hurt, Biochemie Zentrum Heidelberg (YRA1-MYC).

Indirect immunofluorescence and in situ poly(A)+ RNA hybridization

These procedures were performed as described previously (Krebber et al. 1999).

Generation of npl3-27 ts- library

The integrated npl3-27 strains of both mating types, PSY1031 and 1032, were used to generate ts- mutants using a modified protocol as described (Lawrence 1991). The strains were grown to a density of 6 × 107 cells/mL in YPD and were collected by centrifugation and resuspended in 5 mL 0.1 M sodium phosphate at pH 7.0. Cells were mutagenized with 130 µL ethyl methanesulfonate (EMS) to a killing rate of 50%. Cells were incubated for 30 min at 30°C on a roller drum. The mutagenesis was stopped by the addition of 1 mL of 10% (w/v) sodium thiosulfate, and the cells were collected by centrifugation, washed in 5 mL H2O and resuspended in 1 mL H2O. Dilutions were plated on YPD plates to obtain ~300 cells per plate. After 5 d of growth at 25°C, colonies were replica plated to YPD and incubated at 37°C for 5 d. Four hundred and fifteen colonies that did not grow at 37°C were selected for the npl3-27 ts- library.

Isolation of npl3-27 export mutants

The collection of 415 npl3-27 ts- mutants was analyzed for localization of Npl3-27 by indirect immunofluorescence after a shift to 37°C for 30 min for mutants ts300-415 and 4 h for mutants ts1-400. Mutants that displayed >20% of cells with nuclear accumulation of Npl3-27 were backcrossed to a parental npl3-27 strain to determine if the ts- mutation was recessive. The resulting diploids were sporulated and analyzed for the presence of a single ts- mutation. ts- spores were compared against Ts+ spores using indirect immunofluorescence to verify that accumulation of Npl3-27 was linked to the ts- mutation. Each strain was backcrossed to the parent npl3-27 strain two more times to remove undesired mutations resulting from the mutagenesis procedure. Mutations were cloned by complementation of the ts- phenotype by transformation with a CEN URA3 library (Rose et al. 1987).

Northern analysis

Determination of poly(A)+ RNA levels  Fifty mL of cells were grown to log phase (1 × 107 cells/mL) at 25°C and half the culture was shifted to 37°C for 1 h. Total RNA was isolated by the hot acid phenol method, and 2 µg of total RNA was hybridized to a nitrocellulose membrane by slot blot hybridization and probed as described previously (Thompson and Young 1995). The radiolabeled poly dT probe was produced as described previously (Kuldell and Buratowski 1997). Signal was detected and quantitated by PhosphorImager (Molecular Dynamics).

Northern blotting  Fifteen µg of total RNA were separated by agarose gel electrophoresis and transferred to a Hybond N+ membrane (Amersham Pharmacia) by vacuum transfer in 20× SSC. A 32P-labeled 300-bp specific probe for ACT1 was labeled by random priming and hybridized to the membrane in hybridization buffer (50 mM PIPES at pH 7, 100 mM NaCl, 50 mM sodium phosphate at pH 6.9, 1 mM EDTA, 5% SDS, 60 µg/mL sheared salmon sperm DNA) overnight at 65°C and washed three times in 0.5× SSC + 5% SDS at 65°C for 15 min. Signal was quantitated by PhosphorImager.

Chromatin immunoprecipitation

Chromatin IPs were performed essentially as described (Dudley et al. 1999; Kuras and Struhl 1999). Briefly, 400 mL of cells were grown to early log phase (~1 × 107 cells/mL) at 30°C in YPD or YP containing 2% raffinose. For galactose induction, galactose was added to raffinose cultures to a final concentration of 2% and cultures were induced for 20 min. Formaldehyde was added to a final concentration of 1% and cells were incubated at room temperature (RT) for 25 min. Glycine was added to a final concentration of 360 mM. Cells were washed twice in 1× TBS and lysed with glass beads in breaking buffer (0.1 M Tris pH at 8.0, 20% glycerol, 1 mM PMSF) using two 30 sec pulses at speed 6.5 m/sec in a vortexer. Cross-linked chromatin was collected by centrifugation at 14,000 rpm for 1 min, and pellets were washed twice in FA buffer (50 mM HEPES-KOH at pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% DOC) and resuspended in 1.5 mL FA buffer. Cells were sonicated until DNA was of 200 bp average size. Soluble chromatin was separated from insoluble material by centrifugation at 14,000 rpm for 10 min and adjusted to 8 mL with FA buffer. Chromatin was stored in 800 µL aliquots at -80°C.

Immunoprecipitations were performed as described (Kuras and Struhl 1999). For alpha-TBP, 8 µL of antibody was coupled to protein A-sepharose beads. For alpha-Npl3, 25 µL of antibody was coupled to fixed Staphylococcus aureus bacteria. For alpha-myc, 1 µL of 9E11 antibody was coupled to fixed S. aureus. Input and immunoprecipitated DNA was subjected to quantitative PCR as described (Komarnitsky et al. 2000) except 0.15 mCi/mL [alpha-33P]dATP was used. PCR products were separated on an 8% TBE polyacrylamide gel and quantitated by PhosphorImager. A standard curve of six twofold serial dilutions of input in the linear range of PCR was obtained. Four twofold serial dilutions of immunoprecipitate were plotted against the standard curve to determine the percentage of input DNA in each immunoprecipitate. Experiments were performed at least twice, and each experiment yielded similar results.

The sequence of PMA1 primers are the same as described (Komarnitsky et al. 2000). The sequence of GAL10 primers used are GAL10-1: GAGCCCCATTATCTTAGCC and TTACTGC CAATTTTTCCTCT; GAL10-2: TTAAACTTCTTTGCGTC CATCC and TGCTTGGTCAAGACCTCTAACC; GAL10-3: TGTCGTGAGTGGAACTTGGGTT and GCATATCTTCAG CGGAAAATCTGGC; GAL10-4: TGTCAAGGCTTTTCATC CCGATTC and TTGGACCCGTAAGTTTCACCGT; Intergenic region: GAAAAAGTGGGATTCTGCCTGTGG and GT TTGCCACAGCGACAGAAGTATAACC.; tRNAGUC:  STR2963 CACCACAAATGGAAAAGCGACTTTC and STR2964 CCT GTTATTTCCAAAGAACTGGGTTC; tRNACUU STR2967 GCACTAGTTGATTCTTGTTCCAACAG and STR2968 CC GTTTTTCCCCAGAGCACTTTTA (L. Kuras and K. Struhl, unpubl.).

Immunoprecipitation

Immunoprecipitations were performed essentially as described (Hartzog et al. 1998). Cells (50 mL) were grown in YPD at 30°C to mid log phase (2.5 × 107 cells/mL) and lysed with glass beads by vortexing at speed 6.5 for 30 sec in lysis buffer (25 mM NaPO4 at pH 6.8, 0.1 M KOAc, 2 mM MgOAc, 10% glycerol, 1 mM PMSF, 3 ng/mL pepstatin, 3 ng/mL leupeptin, 3 ng/mL aprotinin, 3 ng/mL chymostatin, 0.2 mM Na3VO4, 5 mM -glycerophosphate, 1 mM NaF). Total lysate (1 mg) was added to IP/wash buffer (lysis buffer with 0.5 M NH4OAc, 0.1% Tween 20) to a final volume of 900 µL. Lysates were precleared with 3 µL alpha-Npl3 preimmune serum and 100 µL S. aureus in IP/wash buffer for 1 h. Fourteen µL alpha-Npl3 was added to lysates and incubated overnight. One hundred µL S. aureus was added and incubated for 1 h, and immune complexes were washed five times in 1 mL IP/wash buffer and raised in 20 µL IP/wash buffer. Samples containing RNase A were at a concentration of 50 µg/mL. Samples were incubated for 20 min at RT then washed once with 1 mL of IP/wash buffer and resuspended in sample loading buffer. Samples were run on a 7% SDS-PAGE gel, transferred to nitrocellulose in 10 mM CAPS (pH 11), 1% MeOH and Western blotted with 8WG16 (1:500) and alpha-Npl3 (1:10,000).


rating: 1.00 from 1 votes | updated on: 19 Dec 2006 | views: 7213 |

Rate article:







excellent!bad…