Grape plant material
During the 2000 growing season, grape berries from V. vinifera L. cv. Cabernet Sauvignon plants were collected from the ‘Domaine du Grand Parc’ (INRA, Latresne, France), at different stages of maturity [from 20 to 107 days after flowering (daf)]. Separate seeds and skin/flesh samples were immediately frozen in liquid nitrogen before storage at –80 °C.
Rooted plants obtained from grape cuttings (V. vinifera L. cv. Cabernet Sauvignon) were cultivated on a sandy soil in a growth room programmed for 25/20 °C under a 16/8 h light/dark photocycle and at 75% relative humidity (Ollat, 1998). Leaves were collected at different stages, from apices and very young leaves (2–3 cm wide) to older leaves (9–10 cm wide), to study VvWRKY1 expression in these organs.
Tobacco plants (N. tabacum cv. Xanthi) were grown in vitro at 25 °C on MS medium (Murashige and Skoog, 1962) supplemented with kanamycin (100 mg l–1) for transgenic lines, or without kanamycin for control plants, under a 16 h photocycle at 25/20 °C. Plantlets were transferred to a greenhouse to produce seeds.
VvWRKY1 cDNA isolation, vector construction, and plant transformation
The VvWRKY1 full-length cDNA was cloned from a grape berry cDNA library (V. vinifera L. cv. Cabernet Sauvignon veraison stage; Deluc et al., 2006) by PCR screening with oligonucleotides designed in the consensus WRKY sequence (F, 5'-TGGMGDAARTAYGGRCGAAR-3'; and R, 5'-YTTCGYCCRTAYTTHCKCCA-3'). These primers were used in combination with T7 and 5' primers located in the pTriplex vector (Smart cDNA library construction kit, Clontech, Palo Alto, CA, USA). After cloning in pGEM-T Easy plasmid (Promega, Charbonnières, France), PCR products were sequenced (Genome Express, Meylan, France), and specific oligonucleotides defined within the 5' and 3' non-coding regions were used to amplify VvWRKY1 full-length cDNA.
To overexpress VvWRKY1 in tobacco, XbaI and SacI restriction sites were added, respectively, at the 5' and 3' ends of the cDNA by PCR amplification with modified primers (F, 5'-CTCAATCTAGATCAGTCTCTC-3'; and R, 5'-TCCAAGAGCTCATATGGGTGT-3'). The full-length modified fragment was inserted into a pGEM-T Easy vector and, after restriction with XbaI and SacI, subcloned into the same restriction sites of the binary p35SGiBin19 plasmid (Karimi et al., 2000). The resulting p35SGiBin19-VvWRKY1 containing the full coding sequence of VvWRKY1 in the sense orientation downstream of the 35S promoter was first introduced into Agrobacterium tumefaciens LBA 4404 strain (Hoekema et al., 1983). Tobacco (N. tabacum cv. Xanthi) was then transformed using the leaf disc method (Horsch et al., 1985). Transgenic progeny lines were selected on MS medium supplied with kanamycin (100 mg l–1) and carried to homozygosity.
In vitro VvWRKY1 protein synthesis and electrophoretic mobility shift assay
The VvWRKY1 protein was produced by the in vitro transcription and translation method with the TnT T7 quick system for the PCR DNA system (Promega, Charbonnières, France) according to the manufacturer's instructions. The coding sequence was first amplified with Turbo-Pfu (Stratagene) using the following primer pairs: F, 5'- AGATCCTAATACGACTCACTATAGGGAGCCACCATGAAGGCCACCAAATACTT-3'; and R, 5'- (T)32GGTGAAATGGAAACATTCAT-3', and the PCR product was used as template. Protein detection was performed using the TranscendTM non-radioactive translation detection system (Promega, Charbonnières, France). Double-stranded probes were labelled with [33P]ATP using a 5' end labelling kit (Amersham Pharmacia Biotech, Buckinghamshire, UK) and purified on a 6% non-denaturing polyacrylamide gel in 0.5x TBE buffer at 250 V. The resultant 120 000 cpm labelled DNA probe was incubated with 4 ml of protein reaction mixture, 2 µg of poly(dI–dC)–poly(dI–dC) and the binding buffer (20 mM TRIS, 50 mM NaCl, 10% glycerol, 7 mM ß-mercaptoethanol) in a 20 µl reaction volume. In competition experiments, specific competitor was added in 200-fold molar excess prior to the addition of the protein. The mixture was incubated for 30 min at room temperature and analysed on a non-denaturing 6% polyacrylamide gel in 0.5x TBE buffer at 150 V. The gel was then dried and autoradiographed using a Fujix BAS 2000 system (Fuji Photofilm, Tokyo, Japan).
Wounding and chemical treatments
Two-month-old rooting plants obtained from grape cuttings cultivated in a growth room were used for treatments. For wounding experiments, four fully developed leaves were cut on four sites with scissors and pooled for each time point. For chemical treatments, plants were sprayed with 5 mM salicylic acid (SA), 10 mM ethephon (2-chloroethylphosphonic acid), or 10 mM H2O2. Mock treatments were performed by spraying plants with water. Leaves from three plants were pooled for each time point, frozen in liquid nitrogen, and stored at –80 °C before RNA extraction. All experiments were conducted at least twice. The chemicals were purchased from Sigma (St Louis, MO, USA).
RNA isolation and RT-PCR analysis
Total RNA was isolated from grapevine by the LiCl precipitation method (Asif et al., 2000) and from N. tabacum using the TriReagent method (Molecular Research Center, Cincinnati, OH, USA), according to the manufacturer's instructions. The first-strand cDNA was synthesized from 2 µg of DNase-treated RNA using M-MLV reverse transcriptase (Promega, Madison, WI, USA). To ensure that the PCR products were generated from cDNA and not genomic DNA, proper control reactions were carried out without reverse transcriptase treatment.
PCR amplifications on grape templates were performed using primers specific for the VvWRKY1 gene (F, 5'-GAGAATGATATGGAAAGAGTGG-3'; and R, 5'-CATTCGTTCTCAGACACAATA-3'), the ß-1,3 glucanase gene (F, 5'-GCACTCGCATCAGCAGGC-3'; and R, 5'-GTCACTCTTGAGGGATTC-3'; accession no. AF239617 [GenBank] ), and the elongation factor EF1
gene (F, 5'-GCGGGCAAGAGATACCTCAA-3'; and R, 5'-TCAATCTGTCTAGGAAAGGAAG-3'; accession no. AF176496 [GenBank] ). The number of PCR cycles was 30, 25, and 27 cycles for VvWRKY1, ß-Glu, and EF1, respectively. The tobacco transgene was amplified using specific primers (F, 5'-CCTTTTCCACCAAACATG-3'; and R, 5'-TCATCGCAAGACCGGCAACA-3') with 30 PCR cycles. The Ubiquitin mRNA was amplified as tobacco constitutive control (F, 5'-TCCAGGACAAGGAGGGTAT-3'; and R, 5'-GAGACCTCAGTAGACAAAGC-3'; accession no. U66264 [GenBank] ) with 23 cycles. For each gene, the PCR cycle number chosen was in the log-linear phase of the amplification cycle. RT-PCR products were separated on 1.6% agarose gels, BET stained, and quantified by densitometry using Quantity One software (Bio-Rad). To confirm RT-PCR specificity, the products were inserted into pGEM-T Easy vector (Promega, Charbonnières, France) and subsequently sequenced.
Pathogen challenge of transgenic tobacco
For Pythium F (strain 00PR201, from INRA Bordeaux, France) susceptibility studies, mycelium gelose discs from a 3-d-old culture at 20 °C on V8 medium [V8 vegetable juice 20% (v/v), CaCO3 0.25% (w/v), and agar 17 g l–1) were placed in the crown area of 20 seedlings (3 weeks old) per line. The assay was carried out in Petri dishes containing Whatman paper saturated with water. For each line, a control corresponding to the same number of plantlets inoculated with a disc of V8 agar medium without mycelium was performed. Infected plants were grown in a growth room at 20 °C under a 16 h photocycle. Symptoms were estimated at 7, 10, and 15 d post-inoculation (dpi) according to a scale from 0 to 7 depending on root necrosis development: 0=no symptoms, 1–9=percentage of the root surface that is necrotic; 1=less than 20%, 2=20%, 3=between 30 and 40%, 4=60%, 5=between 60 and 80%, 7=more than 80%, and 9=100%.
For disease susceptibility studies with Peronospora tabacina (downy mildew), Erysiphe cichoracearum (powdery mildew), and potato virus Y (PVYN), strains and inoculum preparations were provided by the Institut du Tabac de Bergerac (ITB, France). For each assay, symptoms were observed on cultivars with different levels of susceptibility (provided by ITB) to validate the progress of the disease. T2 progeny of transgenic lines were analysed and the untransformed N. tabacum cv. Xanthi line was used as control. Seeds were germinated on a blotting paper and transferred after 7 d (two cotyledons-stage) to the greenhouse before inoculation.
For downy mildew (P. tabacina) infections, six plants (10 weeks old) per line were transferred to the growth room (10/14 h light/dark cycle at 22/16 °C). Two leaves per plant were infiltrated on two sites with 100 µl of a sporangia suspension (100 000 spores ml–1) using a needleless syringe. Disease intensity was evaluated 9 dpi by measuring the development of chlorotic flecks around the inoculation site. A second scale was used to estimate the fungal sporulation: 0=no visible symptoms, 1–3=conidia barely detectable, 4–6=moderate amount of conidia production, 7–9=high amount of conidia.
To analyse susceptibility to the powdery mildew agent (E. cichoracearum), 200–500 conidia (as controlled under the microscope) were applied with a cotton tip to two sites of the upper side of two leaves per plant. Twelve plants per line (10 weeks old) were inoculated and maintained in a growth chamber at 23/16 °C under a 10 h photoperiod. After 10 d and 13 d, the percentage of leaf surface covered by powdery mildew mycelium was estimated.
Tobacco plants (4 weeks old) were inoculated with PVYN by rubbing fully expanded leaves with wet carborundum plus PVYN in a 50 mM phosphate buffer, pH 7.0. Two leaves per plant and six plants per line were infected. Plants were maintained in a greenhouse at 20/25 °C. Symptoms were observed 21 d after infection and noted on a scale from 1 to 11 depending on necrotic and mosaic leaf symptom development: 0=no visible symptoms, 3=slight vein clearing on infected leaves, 5=extent of the veins clearing on a few leaves, 7=veinlets and veins become necrotic, 9=vein necrosis extends to at least five leaves, 11=all leaves develop vein necrosis symptoms.
All the data were statistically analysed by analysis of variance (ANOVA) test (P-value
Answers to all your Biology Questions
