Perl script is designed to visualize virtually the features of nucleotide strings. …

• Preface
• I. Introduction
• II. Perl Notation
• III. Syntax
• 1. Perl program for calculating the arithmetic averages
• 2. Perl Program for calculating averages using subroutine
• 3. Perl program for concatenating two sequences
• 4. Perl program for file handling
• 5. Perl Program for File handling For Scalar And Array Variables
• 6. Perl program for calculating the length, total bases, GC and AT counts
• 7. Perl program depicting loop - functions
• 8. Perl program for DNA to RNA transcription
• 9. Perl program to operate array of variables
• 10. If and else operations
• 11. Retrieving protein sequences and locating motifs
• 12. In silico Salient features of DNA
• 13. Perl Program to translate DNA into protein
• 14. Bio-perl programme to retrieve DNA sequence from swissprot
• Appendix

The current program demonstrates the use of “If”, “Elsif” and “Else” operations. We first store a filename in $filename. We then open the file read all the contents of the file and store them in the array and close the file. Each value of the array can be independently addressed by specifying its position. Example as shown in line 6 and 7. The 0^th value (That is the first value of the array. The count starts from (0) of the array is stored in $line1 and the second value is stored in $line2.

So we now ask the user to enter any base sequence. The entered value is stored in the variable $user. Since the user hits the enter button after providing the input, the value stored in $user contains the enter character which should be removed. For that purpose we do chomp on the variable.

Now in line 13, we check if the value entered by the user is present in $line1. The expression ~/$user/ depicts that the value entered by the user can be a part of the complete string in $line1. Else you can just use $line1=$user this means to see if both are equal. But here we just enter one part (substring) of the complete string, therefore we use the expression as in line 13. If the value exists in $line1, it prints out “I found it”. If it is not present in the $line1, we check in $line2. For that reason we use “elsif”. The “elsif” command is used when the “if” condition returned false, that means if the above “if” condition fails. If the above “if” condition is true then the “elsif” line is not executed. So if the value entered by the user is not present in $line1 it checks if it is present in $line2. If it is there it prints “I found it in line2”. If both the condition fails we then have final command called else. That means if the above “if” conditions (if and elsif) fails then the final option is “else”. Here it is not checked with anything it just prints that “I did not find it”

1. #if operation
2. $filename="sample.seq";
3. open(FILE,$filename);
4. @line=<FILE>;
5. close FILE;
6. $line1=@line[0];
7. $line2=@line[1];
8. print"$line1\n";
9. print"$line2\n";
10. print"enter the required base seq: ";
11. $user=<STDIN>;
12. chomp($user);
13. if($line1=~/$user/){
14. print"I found it\n";
15. }
16. elsif($line2=~/$user/)
17. {
18. print"I found it in line2\n";
19. }
20. else{
21. print"I did not find it\n";
22. }
23. exit;

RESULTS

TACTGTGGCCGTGCGTGGCTGCCGTTGCGCTGC

TCCTCGGGTCGATGCGATAGCTAGCTAGATCT

enter the required base seq: TCT

I found it in line2

---2^nd try--------

TACTGTGGCCGTGCGTGGCTGCCGTTGCGCTGC

TCCTCGGGTCGATGCGATAGCTAGCTAGATCT

enter the required base seq: TGC

I found it