Plant material, Pseudomonas syringae growth, plant treatments
Wild-type (WT) N. attenuata plants (seeds collected from a
native population from the DI Ranch, Santa Clara, UT, USA) that had
been inbred for 14 generations were used in this study. Transgenic
plants, irdefensin lines (76 and 96), were produced in the
same WT genetic background. Germination was carried out according to
the procedures described in [27].
Plants were grown in chambers (16/8 hr photoperiod at 25/21°C, and
45–55% relative humidity) and experiments were carried out with
rosette-stage plants 14 days after they were transferred to 1 l pots.
The virulent strain of Pseudomonas syringae pv tomato-DC3000
(PST DC3000) strain was grown and maintained on a LB agar plates at
28°C. The PST DC3000 growth and inoculation procedure was carried out
as described in [28]. In brief, 1 × 105 cells/ml
were resuspended in 0.1% Silwett L-77 solution and intact leaves were
dipped for 1 minute. As a mock inoculation, leaves were dipped in 0.1%
Silwett L-77 solution.
Isolating Nadefensin, and generating and characterizing Nadefensin-silenced plants
Nadefensin was identified as a differentially regulated gene in WT N. attenuata plants that had been damaged by the specialist herbivore M. sexta. The sequence has been submitted in the NCBI database (accession number AY456268) [14].
Using a forward primer (FLTIO-FP: 5'ATGGCTCGATCCTTGTGCTTCATG 3' and a
reverse primer FLTIO-RP: 5'TTAGTTATCCATCATCTCTTC 3'), an Nadefensin sequence
was PCR amplified from the cDNA obtained from PST DC3000-inoculated WT
leaves and this sequence was used to generate transgenic plants irdefensin lines (76 and 96) as described in [9]. In brief, a 225 bp fragment from Nadefensin ORF
was inserted into a pRESC5 transformation vector to create an
inverted-repeat (ir) construct. These constructs were transformed into N. attenuata WT plants using an Agrobacterium-mediated transformation procedure described in [27]. The gene for hygromycin resistance (hptII) allowed transformed plants to be identified easily by selecting hygromycin-resistant individuals [27].
Nucleic acid analysis
Transcript analysis
To analyze Nadefensin transcripts, we extracted total RNA with TRIzol reagent (Invitrogen, http://www.invitrogen.com ) following the TIGR protocol http://www.tigr.org webcite). cDNA was synthesized from 1 μg RNA using the SuperScript™ II RT enzyme (Invitrogen) as described in [29]. The transcripts were analyzed by quantitative real-time PCR (ABI PRISM™7000, Applied Biosystems, http://www.appliedbiosystems.com which was conducted using the qPCR™ core reagent kit (Eurogentec, http://www.eurogentec.com webcite). To analyze Nadefensin,
a specific TaqMan primer pair (forward primer: 5'-AACTATGGCTCG
CTCCTTGTGC-3', the reverse primer: 5'-CTCATAGGCAACAAAAAGCAT-3') and a
double fluorescent dye-labeled probe (5'-TTCATGGCATTTGCAGTCTTGGCAA-3')
were used. The relative gene expression was calculated using a 10-fold
dilution series of cDNAs which had been transcribed from induced RNA
samples from the same experiment.
Analysis of herbivory
Leaf area damage and larval mass
We placed 5-day-old larvae that were previously reared on WT N. attenuata leaves individually on the fully developed leaves of rosette-stage WT and irdefensin lines
(76 and 96) that were either pre-infected with PST DC3000 or left
uninfected (N = 30). Each larva was enclosed in a well-aerated 5 cm
diameter clip cage. The larvae were weighed 6, 9 and 12 days after
feeding. Leaf area damage was estimated at the end of 12 days and based
on the extent of leaf damage, with values ranging from 1 to 5
[1(0–15%), 2(16–30%), 3(31–45%), 4(46–60%), 5(61–75%) and 7(> 76%)]
was assigned.
Analysis of pathogen growth
To quantify the disease spread in WT and irdefensin lines
(76 and 96) plants, we quantified the colony forming units (CFUs) in
PST DC3000 inoculated leaves. In brief, surface-sterilized leaf discs
(1 cm2) were ground in 1 ml sterile water and 40 μl
of supernatant was spread on plates containing LB agar containing
rifamycin and tetracycline. Colonies were counted after 48 h of
incubation at 28°C.
Statistical analysis
Data were analyzed with StatView (Abacus Concepts, Inc.).
Authors' contributions
CR carried out the molecular studies, herbivore and pathogen
bio-assays and statistical analysis. ITB designed and coordinated the
experiments and also helped to draft the manuscript. CR and ITB read
and approved the final manuscript
Acknowledgements
We thank Dr. Klaus Gase, Thomas Hahn, Susan Kutschbach, Antje
Wissgott, and Wibke Kroeber for assistance in preparing, cloning,
sequencing analysis, and bacterial inoculations; Emily Wheeler for
editorial assistance; and the Max Planck Society for funding.
Answers to all your Biology Questions
