Login

Join for Free!
114824 members
table of contents table of contents

One of the key tools for determining the social structure of wild …


Biology Articles » Methods & Techniques » Fast and non-invasive PCR sexing of primates: apes, Old World monkeys, New World monkeys and Strepsirrhines » Table 1

Table 1
- Fast and non-invasive PCR sexing of primates: apes, Old World monkeys, New World monkeys and Strepsirrhines

PCR primers, degeneracy and annealing temperatures (Ta).

Primer name
Primer sequence (5'-3')1
Degeneracy
Ta°C

UTX/UTY
TGCTACCTCAGGTGGACAACAAGG
1
62
UTY
TGCTTGTTTCAGGCACCAAGGRTCTATK
4
62
UTX
CTCGACACTGGCAGTGCTGTTAGG
1
62

1Degenerate nucleotides are shown in bold.


rating: 5.00 from 1 votes | updated on: 11 Aug 2009 | views: 6537 |

Rate article:







excellent!bad…