Answers to all your Biology Questions
table of contents  One of the key tools for determining the social structure of wild … '); |
Biology Articles » Methods & Techniques » Fast and non-invasive PCR sexing of primates: apes, Old World monkeys, New World monkeys and Strepsirrhines » Table 1
Table 1
|
||||||||||||||||||||||||||||||||
|
PCR primers, degeneracy and annealing temperatures (Ta). |
|||
| Primer name |
Primer sequence (5'-3')1 |
Degeneracy |
Ta°C |
|
|
|||
| UTX/UTY |
TGCTACCTCAGGTGGACAACAAGG |
1 |
62 |
| UTY |
TGCTTGTTTCAGGCACCAAGGRTCTATK |
4 |
62 |
| UTX |
CTCGACACTGGCAGTGCTGTTAGG |
1 |
62 |
|
|
|||
|
1Degenerate nucleotides are shown in bold. |
|||
rating: 5.00 from 1 votes | updated on: 11 Aug 2009 | views: 4880 |
© Biology-Online.org. All Rights Reserved. Register | Login | About Us | Contact Us | Link to Us | Disclaimer & Privacy