Login

Join for Free!
118326 members
table of contents table of contents

Available in vitro and in vivo methods for verifying protein substrates for …


Biology Articles » Biochemistry » Protein Biochemistry » Farnesylation or geranylgeranylation? Efficient assays for testing protein prenylation in vitro and in vivo » Methods

Methods
- Farnesylation or geranylgeranylation? Efficient assays for testing protein prenylation in vitro and in vivo

Construct production and cloning

We generated plasmids containing GST- and pEGFP-fusions of all genes studied in this work. The cDNAs of Rap2A (IMAGE clone ID IMAGp998M0310712, Genbank accession BC070031), RasD2 (IMAGp958D21250, BC013419), v-Ki-Ras2B (IMAGp998J059643Q1, BC013572) and the open reading frame coding for RhoA63L (provided as pEGFP C1-vector by C. J. Der, UNC USA; in contrast to the wild type form, this mutant is permanently activated and is able to induce malignant transformation of cells [55]) were cloned into the pGEX5X1-vector (pGEX4T1 for RhoA63L), thereby creating N-terminal GST-fusion proteins. The Stratagene QuikChange XL Site-Directed Mutagenesis Kit was used to introduce cysteine-to-alanine mutations in the CaaX-motifs. Since this residue is the site of covalent thioether linkage of the isoprenoid modification, the ability to become modified should be abolished. For RhoA63L, the already available cysteine-to-serine mutant (cloned into the pEGFP C1-vector as supplied by C. J. Der, UNC USA) has been used. N-terminal GFP-fusion proteins were used to investigate the subcellular localization in transiently transfected HeLa-cells. Therefore, both wildtype and mutant cDNA of Rap2A, RasD2, and v-Ki-Ras2 were also cloned into the pEGFP C2-vector.

In vitro prenylation assay

The cDNA of the GST-fusion proteins was amplified by PCR using standard conditions. A 5'-primer has been designed especially for in vitro transcription/translation, containing a promoter, a Kozak-Consensus-sequence and an annealing sequence for the GST-tag: 5' gcgtaatacgactcactatagggagaccaccatgtcccctatacttaggttattgg 3' A 3'-primer sequence 5' agatcgtcagtcagtcacgat 3' has been designed to anneal in the pGEX5X1-vector downstream of the insert, allowing the use of the same primer pair for all proteins. All oligonucleotides used were synthesized by MWG Biotech. The radioactive label of choice (typically, 20 μCi [3H]mevalonic acid, 10 μCi [3H]FPP or [3H]GGPP, all purchased from American Radiolabeled Chemicals) was dried in a speedvac under vacuum at room temperature to remove the solvent, since ethanol could disrupt the transcription/translation reaction. 20 μl rabbit reticulocyte lysate, 0.5 μl PCR-Enhancer, 0.5 μl methionin (all supplied with the Promega TNT Quick Coupled Transcription/Translation Kit) and 2.5 μl of the PCR-reaction were added, mixed and incubated at 30°C for 4 hours. For experiments with inhibitors of prenyltransferases, the whole mixture including 50 μM of the appropriate inhibitor, but without the DNA, was incubated for 30 min on ice. Then, the reaction was started by addition of DNA. The following steps were identical in all experiments. During the incubation of the reaction mixture, 50 μl glutathione sepharose 4B-beads (75% slurry, from Amersham Biosciences) were separately resuspended in 0.5 ml PBS and spun down in a microcentrifuge at 1.600 rpm for one minute. The supernatant was removed and the washing step repeated once to equilibrate the beads for protein binding. The whole TNT-reaction-mix and PBS to a final volume of 200 μl was added. After resuspension, the beads were incubated with gentle agitation at room temperature for 1 hour. Afterwards, they were washed 5 times with 0.5 ml PBS. Following the last washing step, 50 μl of elution buffer (10 mM reduced glutathione in 50 mM Tris-HCl, pH 8.0) were added and incubated again for 1 hour with agitation. The beads were spun down, the supernatant transferred to a fresh vial and the protein precipitated by addition of 0.5 ml ice-cold acetone. The mixture was spun at 10.000 rpm for 1 minute. The supernatant was carefully decanted and the pellet air-dried for 10 minutes.

The pellet was re-suspended in sample buffer, incubated at 80°C for 10 min and resolved by SDS-PAGE (15%). The protein was transferred from the gel to a nitrocellulose membrane by electroblotting. The membrane was left to dry. Each lane was scanned separately for 20 min using a Berthold TLC linear analyzer LB 282. The spatial resolution of the scanner allows to assign each signal to a certain protein size. Following this measurement, the membrane was blocked with 10% milk powder in PBS. After incubation with primary antibody (anti-GST-antibody from rabbit, 1:5000) and secondary antibody (ECL Anti-rabbit IgG, Horseradish peroxidase linked whole antibody from donkey purchased from Amersham Biosciences, 1:10.000), addition of ECL plus Western Blotting Detection solution and exposure of a Hyperfilm ECL (both from Amersham Biosciences) for 15 seconds, a band at a molecular weight corresponding to the signals measured by the TLC analyzer is detectable.

Determination of differential electrophoretic mobility after expression in cell culture

For N-terminal tagging, the ORFs of Rap2A (wild-type) and the Rap2A C180A mutant form were cloned into the plasmid pCIneo-HA [70]. HeLa cells were cultured on 6-well plates in DMEM/10% FCS to 50% confluency. We transiently transfected the cells with 1 μg DNA using Lipofectamine Reagent and Plus Reagent (Life Technologies) according to the manufacturers manual. After 3 hours of incubation, the transfection medium was replaced by fresh DMEM/10% FCS with or without 50 μM Lovastatin (Sigma). For analyzing the effect of a FPP gradient, two samples with either 2 μM or10 μM FPP have been prepared.

Ca. 16 hours later, extracts were prepared with lysis buffer (50 mM Hepes, 140 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 0.1% (w/v) Sodium Deoxycholic acid, Complete Protease Inhibitor Cocktail (Roche)). Before loading the samples onto a 16% SDS Gel, the extracts were centrifuged for 10 minutes at 13000 rpm using a table top centrifuge and the supernatants boiled with sample buffer for 5 minutes. The proteins were transferred to nitrocellulose membranes and probed with mouse anti-HA 12CA5 antibodies and HRP-conjugated secondary antibodies.

Determination of intracellular localization

HeLa cells were plated at low density on coverslips. Then, they were transfected with GFP-expression vectors carrying the cDNA's of Rap2A, RasD2, v-Ki-Ras2 and RhoA63L using Lipofectamine and Plus Reagent in serum-free medium (Life Technologies) for 3.5 h. After washing, the cells were maintained in growth medium for 14 h. Cells were rinsed with PBS, fixed in 2% formaldehyde in PBS for 20 min, washed with PBS, permeabilized with 0.1% Triton X-100 in PBS for 10 min, washed with PBS and mounted in vectashield (vector laboratories) for direct fluorescence of GFP. The effect of farnesylation or geranylgeranylation inhibitors was assessed by treatment of the cells with FTI-277 (10 μM) or GGTI-298 (5 μM) (Sigma) during maintenance in growth medium for 14 h. Cells were observed using an Axiplan 2 Imaging Microscope (Zeiss). GFP- as well as DAPI-images were acquired with a Coolsnap HQ camera (Photometrics) and analyzed using the software Metamorph 6.2r4 (Universal Imaging Corp.).

In vivo prenylation assay with HA-tag-based immunoprecipitation from cell culture and Western blot TLC scanning

Transfection and labelling

For N-terminal tagging, the ORFs of Rap2Awt and Rap2AC180A were cloned into the plasmid pCIneo-HA [70]. HeLa cells were cultured on 6 well plates in DMEM/10% FCS to 50% confluency. We transiently transfected the cells with 1 μg DNA using Lipofectamine Reagent and Plus Reagent (Life Technologies) according to the manufacturers manual. After 3 hours of incubation, the transfection medium was replaced by DMEM/10% FCS/30 μM Lovastatin (Sigma). Four hours later, the medium was replaced by DMEM/10% FCS/30 μM Lovastatin (Sigma) containing 400 μCi 3H-FPP (ARC).

Immunoprecipitation

After ca. 16 hours, extracts were pre-cleared with Dynabeads M-280 Sheep anti-Mouse IgG (Dynal) in lysis buffer (50 mM Hepes, 140 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X-100, 0.1% (w/v) Sodium Deoxycholic acid, Complete Protease Inhibitor Cocktail (Roche)) at room temperature for 3 hours. Immunoprecipitation was performed with mouse anti-HA 12CA5 antibodies crosslinked to magnetic Dynabeads M-280 Sheep anti-Mouse IgG (Dynal) at 4°C over night. We washed the beads 3 times with lysis buffer and twice with lysis buffer containing 500 mM NaCl. Before loading the samples onto a 10 % SDS Gel, the beads were boiled in sample buffer for 5 minutes. The proteins were transferred to nitrocellulose membranes and monitored for incorporation of 3H-FPP anchors by TLC analysis. Subsequently, we probed the Western blots with mouse anti-HA 12CA5 antibodies and HRP-conjugated secondary antibodies. Magnetic beads were washed three times with TBS-T (0.01% Triton X-100) and incubated with mouse anti-HA 12CA5 crude serum at 4°C over night.

Crosslinking to beads

The beads were again washed 3 times with TBS-T and 3 times with 0.2 M Sodiumborate pH 9.0. We crosslinked beads and antibodies with 20 mM DMP in 0.2 M Sodiumborate pH 9.0 for 15 minutes at room temperature. Finally, the beads were washed 3 times for 15 minutes with 1 M Tris pH 8.0 and 3 times with TBS-T.


rating: 2.00 from 1 votes | updated on: 14 Nov 2007 | views: 8219 |

Rate article:







excellent!bad…