Login

Join for Free!
119284 members
table of contents table of contents

The authors unravelled new important molecular genetic details about fish orthologous DGs


Biology Articles » Zoology » Ichthyology » Duplication of the dystroglycan gene in most branches of teleost fish » Tables

Tables
- Duplication of the dystroglycan gene in most branches of teleost fish

Table 1

DG genes details based on genomic DNA sequences available at the Ensembl databank





gene structure exon/intron (bp)


SPECIES
GENE
ID ENSEMBL
GENOME LOCATION
exon1
intron1
exon2
mini-intron
exon3
total length (bp)
precursor (aa)
H. sapiens
DAG1
ENSG00000173402
chromosome 3
285
19977
2403
no
no
22665
895
M. musculus
DAG1
ENSMUSG00000039952
chromosome 9
279
8351
2403
no
no
11033
893
D. rerio
DAG1
ENSDARG00000016153
chromosome 22
321
15186
2280
no
no
17787
866
T. rubripes
DAG1a
NEWSINFRUG00000153220
scaffold 2682
336
2938
435
137
> 1689
> 5674
> 820
T. rubripes
DAG1b
NEWSSINFRUG00000136139
scaffold 75
366
818
2307
no
no
3491
890
T. nigroviridis
DAG1a
GSTEN00009405001
scaffold SCAF11228
?
> 606
441
137
1857
> 3041
> 765
T. nigroviridis
DAG1b
GSTENG00033210001
scaffold SCAF15033
369
779
2313
no
no
3461
893
O. latipes
DAG1a
ENSORLG00000010935
chromosome 5
297
22628
459
86
1818
25288
857
O. latipes
DAG1b
ENSORLG00000009878
chromosome 7
312
839
2283
no
no
3434
864
G. aculeatus
DAG1a
ENSGACG00000003062
group XVII 379.49 k
?
?
462
116
1827
> 2405
> 762
G. aculeatus
DAG1b
ENSGACG00000002661
group XII 444.80 k
312
1026
2301
no
no
3639
870
D. labrax
DAG1a
NCBI accession code DQ149510
?
?
?
> 90
116
> 1783
> 1989
> 624

Details relative to the newly identified partial DG sequence from D. labrax are also included.

Table 2

Reciprocal alignment scores of human and fish DAG1 genes obtained with ClustalW


H. sapiens DAG1
D. labrax DAG1a
T. nigroviridis DAG1a
T. rubripes DAG1a
O. latipes DAG1a
G. aculeatus DAG1a
T. nigroviridis DAG1b
T. rubripes DAG1b
O. latipes DAG1b
G. aculeatus DAG1b
H. sapiens DAG1
-
66
64
55
57
64
53
53
54
55
D. labrax DAG1a
66
-
84
80
80
90
68
68
64
69
T. nigroviridis DAG1a
64
84
-
77
73
79
63
63
60
66
T. rubripes DAG1a
55
80
77
-
68
74
58
57
55
57
O. latipes DAG1a
57
80
73
68
-
78
57
57
55
58
G. aculeatus DAG1a
64
90
79
74
78
-
64
63
62
65
T. nigroviridis DAG1b
53
68
63
58
57
64
-
90
75
80
T. rubripes DAG1b
53
68
63
57
57
63
90
-
74
79
O. latipes DAG1b
54
64
60
55
55
62
75
74
-
75
G. aculeatus DAG1b
55
69
66
57
58
65
80
79
75
-

The DAG1a and DAG1b orthologues have been highlighted in bold.

Table 3

Primers used in the PCR experiments

Fish
Primer
Sequence primer (5'-3')
D. rerio
DAG1_s
CCAGCCTTTCATCTGTGGCAA
D. rerio
DAG1_as
CTTCGCACCCTTTTGGGCAC
D. rerio
ACT_s
TCTTGACCCTGAAGTACCCCATT
D. rerio
ACT_as
TCCTTGATGTCGCGCACAAT
D. labrax
FISH_ext_s
GGGCTTCAGCACATGAAGAT
D. labrax
FISH_ext_as
CTGTAGGG(A/G)GTCATGTTCTT
D. labrax
ACT s
TCCTGACCCTGAAGTACCCCA
D. labrax
ACT as
TTGATGTCACGCACGATTTCC
T. nigroviridis
DAG1a s
CAGACGTTCCTGTGTGAGGGG
T. nigroviridis
DAG1a as
GCTTCGGAAGGTGCTGCTTC
T. nigroviridis
DAG1b s
AGCTCAGCCTCTCACCTGTAGC
T. nigroviridis
DAG1b as
GACTCGTTTCACTCCATGGACC
T. nigroviridis
ACT s
CACCCTGAAGTATCCCATCGAA
T. nigroviridis
ACT as
GTCTCTGACGATCTCTCGCTCAG

The primers used to amplify the gene sequences from D. rerio and T. nigroviridis were designed using the sequences available in the database. The degenerate primers FISH_ext_s and FISH_ext_as, which allowed the fishing of the newly identified D. labrax sequence, were chosen exploiting two regions displaying very high homology within the aligned DG sequences from D. rerio and T. rubripes (see also Fig. 1).


rating: 0.00 from 0 votes | updated on: 22 Oct 2007 | views: 3937 |

Rate article:







excellent!bad…