
Join for Free!
122127 members

table of contents table of contents

Taken together, these data form a primary framework for understanding the evolution …

Home » Biology Articles » Zoology » Mammalogy » Differential expression of WNT4 in testicular and ovarian development in a marsupial » Table 2

Table 2
- Differential expression of WNT4 in testicular and ovarian development in a marsupial

Primers designed for the analysis of WNT4 expression by PCR

Primers Sequence (5'→3') Function
csF1 GTCATCGGTGGGCAGCATCTC Cross species cloning
csR1 CGTGACACTTGCACTCCACCC Cross species cloning

F, forward primers in the 5' to 3'; R, reverse primers in the 3' to 5' direction. q, quantitative PCR primers for real time analysis; CDS, Smart IV and 5'PCR were synthesized by SIGAMA (Genosys) according to the manual of the SMART cDNA library construction kit from Clontech.

rating: 1.00 from 1 votes | updated on: 22 Jul 2008 | views: 7532 |

Rate article:
