Login

Join for Free!
16760 members
table of contents table of contents

a chemical genetic screen designed to address the mechanism of action of …


Biology Articles » Genetics » Chemical Genetics Reveals an RGS/G-Protein Role in the Action of a Compound » Materials and Methods

Materials and Methods
- Chemical Genetics Reveals an RGS/G-Protein Role in the Action of a Compound

All experiments that involved collecting and processing animal tissue samples were performed using animal test methods approved by the Bristol-Myers Squibb Institutional Animal Care and Use Committee, and in accordance with the Guide for the Care and Use of Laboratory Animals as adopted and promulgated by the National Institutes of Health.

Rat whole bladder ex vivo model.

The model used for functional experiments was a modified version of that described in 1986 by Malkowicz et al. [49]. Briefly, a female rat (250–350 g) (Harlan Sprague Dawley, Indianapolis, Indiana, United States) was sacrificed by decapitation. The bladder was excised, cleaned of connective tissue, and the ureters were tied. The bladder was catheterized at the urethral opening and mounted in a 50-ml organ bath containing normal Kreb's buffer (composition in mM: NaCl 118.4, KCl 4.7, KH2PO4 1.2, MgSO4 1.3, CaCl2 1.8, Glucose 10.1, NaHCO3 25, gassed with 95% O2/5% CO2, 37 °C). The bladder was infused with normal Kreb's buffer at 0.05 ml/min for 30 min to a maximum volume of 1.5 ml. The pressure developed in the bladder during the infusion was measured using a pressure transducer (model P23XL, Ohmeda, Norcross, Georgia, United States) and an AcKnowledge data acquisition system (MP100WS, Biopac Systems, Goleta, California, United States). At the end of infusion the bladder was allowed to empty and the volume of “spontaneous” bladder emptying was measured. Carbachol (1 and 10 μM) was added to the bath to induce complete bladder emptying (unpublished data). Bladders were subjected to a series of three infusions: 1) a “conditioning” infusion with normal Krebs followed by a 1-h recovery period; 2) a “control” infusion followed by 1-h incubation with BMS-195270 or vehicle (in paired controlled experiments); and 3) a final infusion in the presence of BMS-195270 or vehicle. Statistical analysis of the data was performed using an unpaired t-test; p

Ca++ flux assays.

HEK293 cells or primary human bladder cells were seeded at a density of 5 × 104 per well on Poly-D-lysine–coated 96-well white/clear Biocoat microtiter plates (Becton-Dickinson, Bedford, Massachusetts, United States) overnight in DMEM +10% FBS. Cells were washed 3× in 100-uL Kreb's buffer (NaCl 118 mM, KCl 4.7 mM, MgSO4 1.2 mM, KH2pO4 1.2 mM, NaHCO3 4.2 mM, D-Glucose 11.7 mM, CaCl2 1.3 mM, Hepes [pH 7.4] 10 mM). Cells were equilibrated (“loaded”) with 4 uM Fluo-4 (Molecular Probes, Eugene, Oregon, United States) in Kreb's buffer containing 0.08% (wt/vol) Pluronic F-127 and 0.25 mM sulfinpyrazone for 1 h with the plate covered in foil. Cells were washed 2× in 100-uL Kreb's buffer containing 0.5% BSA and 0.25 mM sulfinpyrazone. The BMS compound stocks were made up in DMSO and diluted to working concentrations in Kreb's buffer containing 0.5% BSA and 0.25 mM sulfinpyrazone. 100uL of either the test compound or vehicle was added to the wells and the plate incubated for 15 min at room temperature. The [Ca2+]i signal was evoked by addition of histamine or carbachol at the concentrations indicated in figure legends. Two detection systems were used and yielded similar results. In system one, Fluo-4 was excited at 488 nm and fluorescence emission at 510 nm was determined simultaneously from multiple wells in a time-resolved mode (1 Hz frequency) using a fluorometric plate reader (FLIPR, Molecular Devices, Sunnyvale, California, United States). Relative fluorescence intensity was used as indication of evoked [Ca2+]i signal. Data acquisition and preliminary analysis was performed using FLIPR software (Molecular Devices). Alternatively, Fluo-4 was measured with the 488 excitation/535 emission filter set on a well-by-well basis using a Wallac Victor2 fluorometer (PerkinElmer, Boston, Massachusetts, United States). In both systems, a baseline fluorescence was measured at each second for 5 s, followed by agonist injection. Subsequent readings were taken at each second up to 60 s and then every 2.5 s up to 75 s. The EC50s were obtained and graphs generated using GraphPad Prism software (GraphPad Software). The EC50 for BMS 195270 in these assays was 2 μM and for BMS-192364 was 9 μM.

For experiments with niguldipine pretreatment, cells were loaded with Fluo-4 dye as described above. Treatment with 100 μM niguldipine (IC50 75 nM, Sigma-Aldrich, St. Louis, Missouri, United States) was initiated 15 min prior to addition of the small molecules under test. Control wells received an equal concentration of vehicle. The cells were then treated with either test small molecules or vehicle for 15 min, followed by stimulation with 100 μM carbachol.

For experiments with pertussis toxin, cells were pretreated for 24 h in complete media with 150 ng/ml pertussis toxin (Calbiochem, San Diego, California, United States) or a vehicle control. Cells were then washed 3× in media and loaded with Fluo-4 as described above. Cells were then treated with either test small molecules or vehicle for 15 min followed by stimulation with 100 μM carbachol.

Radio-ligand binding assays.

All radio-ligand–binding and GTP-γS assays were carried out by MDS Pharma Services, Taiwan. M1–M5 muscarinic receptor assays were carried out essentially as in [28,29]: recombinant M1–M5 were expressed in CHO cells and were used in a modified Tris-HCL buffer (pH 7.4). A 16-mg aliquot was incubated with 0.8 nM {3H}N-methylscopolamine for 120 min at 25 °C. Nonspecific binding was estimated in the presence of 1 μM atropine. Membranes were filtered and washed. The filters were counted to determine the specifically bound 3H. BMS compounds were tested at 10 μM.

Calcium channel–binding assays were carried out essentially as in [30,34]. Briefly, frontal lobe brains of male Wistar-derived rats weighing 175 g were used to prepare N- or L-type calcium channels in modified Tris-Hcl buffer (pH 7.4). A 40-ug aliquot was incubated with either 10 pm {125I}ω-conotoxin GVIA (N-type channel inhibitor) for 30 min at 4 °C, or a 0.5 mg aliquot was incubated with 2 nM {3H} diltiazem for 180 min at 4 °C. Nonspecific binding was estimated in the presence of either 100nm ω-conotoxin GVIA or 10 μM diltiazem. Membranes in each case are filtered and washed with the filters subsequently counted for radioisotope. BMS compounds were screened at 10 μM.

M4 and H1 GTP-γS assays were carried out under standard conditions in both agonist and antagonist modes [47,48]. Briefly, human muscarinic receptor M4 was expressed in Sf9 cells. Test compound was pre-incubated with 0.2 mg/ml membranes and 3 μM GDP for 20 min at 25 °C in modified HEPES buffer (pH 7.4). SPA beads were added for another 60 min at 30 °C. The reaction was then initiated by addition of 0.3 nM {35S}GTP-γS for 15 min. BMS compounds were tested at 10, 1, 0.1, and 0.001 μM for their ability to increase GTP-γS binding relative to 10 μM McN-A-343 (indicating possible agonist activity), or to inhibit an increase in binding rendered by 1 μM dopamine. For histamine H1 assays, the receptor was expressed in CHO cells. BMS compounds were pre-incubated with 0.022 mg/ml receptor and 1 μM GDP in modified HEPES buffer (pH 7.4) for 20 min at 25 °C, SPA beads were added for another 60 min at 30 °C. The reaction was then initiated by addition of 0.3M {35S}GTP-γS for 30 min. BMS compounds were tested at 10, 1, 0.1, and 0.001 μM for their ability to increase or decrease GTP-γS binding relative to 10 μM histamine, indicating possible agonist or antagonist activity.

Phenotypic and genetic analysis of C. elegans.

C. elegans strains were cultured and maintained according to standard procedures. All strains were assayed at 20 °C unless otherwise indicated. Sequence analysis showed that the eat-16(ad702) allele carries an AG AA mutation in the splice acceptor site before the fourth exon, which results in early termination before the RGS domain that interacts with G-αq. This allele shows no additional phenotypes when placed opposite a chromosomal deficiency that deletes the entire RGS protein coding region; i.e., it behaves as a null allele for eat-16.

Small-molecule treatment of C. elegans.

Treatment of C. elegans with the small molecules was conducted as follows: a solution of the small molecule in DMSO was mixed with a slurry of killed bacteria (strain OP50, taken through multiple freeze–thaw cycles) to twice the desired final concentration. Adult wild-type or mutant hermaphrodites (Bristol N2 strain) were collected in standard M9 media. Worms were mixed with the small-molecule/bacteria slurry in a 1:1 ratio, and plated on peptone-free NGM plates. The final DMSO concentration did not exceed 1%. At 1, 2, 4, 8, and 16 h of treatment, worms were observed and assessed for behavioral and visible defects.

For egg-laying assays, adults were treated overnight with the small molecule. Approximately thirty animals were then loaded onto agar pads made on glass slides, and examined under Nomarski optics. Animals were scored as egg-laying defective if they contained developing (“comma stage”) embryos.

EMS mutagenesis/screening of C. elegans.

EMS mutagenesis was conducted according to standard procedures [50]. Briefly, Bristol N2 hermaphrodites of L4 stage were treated with 0.25% EMS (Sigma-Aldrich) in M9 for 4 h at 20 °C. Worms were washed 4× in M9 media, and plated onto seeded NGM plates. Staged collections were taken of the F1 generation, and these were plated onto NGM plates at either 20 °C or 15 °C. Staged collections of the F2 generation were plated onto NGM plates and allowed to grow until adulthood. These adults were then collected and treated with small molecule. After an overnight treatment with the test compounds, animals that were not visibly egg-laying defective were isolated and retested for resistance to small molecule.

Characterization of alleles from C. elegans mutants.

Mutant hermaphrodites were crossed to males of the polymorphic strain CB4856 (Hawaiian isolate). Recombinant homozygous mutants in the F2 generation were selected by their visible phenotype and assayed for SNPs. Genotyping of SNP markers was performed using standard methods and employed SNPs identified either through the Washington University SNP project or privately at Exelixis. The map data generated was as follows:

egl-30(ep271): ChrI; −17.9 cM to −5.53 cM (~1700 kb)

ep272: Chr I; −10.31 cM to −8.76 cM (~150 kb)

eat-16(ep273): ChrI; 2.63 cM to 4.4 cM (~2 Mb)

goa-1(ep275): ChrI; 2.03 cM to 3.74 cM (~2.6 Mb)

For the eat-16(ep273), egl-30(ep271), and goa-1(ep275) alleles, the identity of the mutant gene was confirmed by sequence analysis of PCR products templates upon genomic DNA from the mutant strains. Sequencing of PCR products was performed according to manufacturer's instructions (Applied Biosystems, Foster City, California, United States).

Construction and analysis of yeast strains.

Centromeric vectors from the pRS series [43] were used to provide GPA1 and SST2 gene functions as follows. A 2.8-kb PCR fragment containing the wild-type yeast GPA1 gene and promoter was amplified from genomic DNA using primers CGGGATCCAAGAGCCCAAGTATGTAA and CGGGATCCTCATATAATACCAATTTTT and cloned into pCR.TOPO2.1 (Invitrogen, Carlsbad, California, United States). A BamHI fragment containing the amplicon was moved to pJC72 (pRS415 with the PHO5 transcription terminator) to create plasmid pJC73. Site-directed mutagenesis of pJC73 using the Quikchange system (Stratagene, La Jolla, California, United States) with the oligonucleotide primers GGATGAAAGAGTGAACAGAATTCATGAATCAATAATGCTATTTG and CAAATAGCATTATTGATTCATGAATTCTGTTCACTCTTTCATCC generated plasmid pJC74, containing the gpa1-M362I substitution. The full GPA1 gene sequence was confirmed in pJC73 and pJC74. To provide Sst2 function, a 2-kb amplicon containing the coding sequence was generated from genomic DNA using primers GAGGATCCATGGTGGATAAAAATAGGACG and CGGTCGACTTAGCACTTTTCTTGGATTTC. The amplicon was cloned into p416-TEF (pRS416 with the TEF1 promoter sequence and the CYC1 terminator) to create plasmid pJC156.

Strain Y87 (MATa gpa1 sst2 leu2 ura3 his3) was isolated from a meiotic tetrad that showed 2:2 segregation of G418-resistance from a cross between RG6055 and RG16602 (Research Genetics, Huntsville, Alabama, United States). Y87 has the slow growth phenotype expected of a gpa1 mutant; this phenotype was complemented following transformation with pJC73 or pJC74. For halo assays, a suspension of yeast cells (OD600 0.3) was poured onto solid yeast growth medium and the excess liquid drained. Medium was synthetic complete minus leucine for pJC73 or pJC74; synthetic complete minus uracil and leucine for pJC73 or pJC74 with pJC156. 10 μl of a 2-mg/ml solution of α-factor in water was placed on a 7-mm glass fiber disc (Schleicher and Schuell Bioscience, Keene, New Hampshire, United States) at the center of the plate. Plates were incubated at 30 °C for 24 h before photography.

Acknowledgments

We thank Dr. Piyasena Hewawasam for small-molecule synthesis, and Dr. Mark Harpel, Dr. Stan Hefta, Dr. Robert Grafstrom, Dr. Siew Ho, and Dr. Greg Plowman for critical reading of this manuscript.

Author contributions. KF, ST, LM, JC, PC, RC, SD, JK, NJL, SGW, MC, JWS, PRM, and RMK conceived and designed the experiments. KF, ST, LM, LB, BB, JC, RC, YF, HW, YZ, SGW, JWS, and RMK performed the experiments. KF, ST, LM, PC, RC, JK, YZ, SGW, JWS, PRM, and RMK analyzed the data. ST, YD, HK, SRK, Jr., NJL, RP, JS, TS, GT, and AvdL contributed reagents/materials/analysis tools. KF, PRM, and RMK wrote the paper.


rating: 0.00 from 0 votes | updated on: 24 Jul 2007 | views: 856 |

Rate article:







excellent!bad…