
Join for Free!
122371 members

table of contents table of contents

The goal of this study was to examine global alterations in gene …

Home » Biology Articles » Biochemistry » Lipid Biochemistry » Alterations in lipid metabolism gene expression and abnormal lipid accumulation in fibroblast explants from giant axonal neuropathy patients » Tables

- Alterations in lipid metabolism gene expression and abnormal lipid accumulation in fibroblast explants from giant axonal neuropathy patients

Table 1

Differentially expressed genes in GAN vs. normal fibroblasts as analyzed by oligonucleotide microarrays. Genes selected displayed at least a three-fold difference in expression level.

Acc. number
Fold change
Genes involved in lipid metabolism and adipogensis
Complement component 3 precursor
Fatty acid binding protein 5
ATP-binding cassette A6
Meltrin alpha
ATP-binding cassette B4
Acyl coenzyme A:cholesterol acyltransferase

Integral membrane proteins and receptors
GABA-B receptor
Integrin, beta 3
GABA-B receptor R2
GABA-B receptor splice variant 1
Orphan G protein-coupled receptor
Integral membrane serine protease
Hyaluronan-mediated motility receptor
Death receptor 6
Endothelin receptor
P-glycoprotein (mdr1)
Membrane glycoprotein M6
Glycoprotein M6A
Potassium channel beta subunit
Endothelin receptor type B
Potassium channel beta 1a subunit

Cell division/proliferation/apoptosis
PDZ-binding kinase
Mitosin (CENPF)
Dickkopf homolog 1
Kinetochore associated 2
Cell division cycle 2
Tumor necrosis factor-related protein
EGF-like-domain, multiple 6

Transcription factors and nuclear proteins
Transcription factor AP-2 alpha
High mobility group AT-hook 1
Nuclear factor IB
Interferon-inducible protein p78

Stathmin-like 2

Pregnancy specific beta-1-glycoprotein
Pregnancy specific beta-1-glycoprotein 7
Pregnancy specific beta-1-glycoprotein 4
Pregnancy specific beta-1-glycoprotein 1

Uncharacterized genes
Hypothetical protein PRO02730
Uncharacterized bone marrow protein
Hypothetical protein FLJ10517
KIAA0101 gene product
KIAA0008 gene product
Doublecortin and CaM kinase-like 1
KIAA1547 gene product
Hypothetical protein DKFZp762E1312
Hypothetical protein FLJ10829
Clone HQ0310 PRO0310p1
Hypothetical protein DKFZp564H1916
KIAA0042 gene product
Hypothetical protein FLJ22009
Hypothetical protein FLJ23468
Hypothetical protein DKFZp564N1116
Hypothetical protein FLJ10781
Hypothetical protein DKFZp564B052
KIAA0008 gene product
KIAA0865 gene product

Matrix metalloproteinase 1
Carbonic anhydrase XII
Topoisomerase II alpha
Step II splicing factor SLU7
Monocyte chemotactic protein
Ribonucleotide reductase M2
Plasminogen activator, urokinase
Cathepsin C
Atrophin-1 interacting protein 1
Monoamine oxidase A
Type II iodothyronine deiodinase
Phosphatidylserine-binding protein
Scrapie responsive protein 1
Natural killer cell transcript 4
CD24 signal transducer
Elastase 2
CD24 antigen

Table 2

Quantitative RT-PCR conditions and gene-specific primer sequences.

Quantitative PCR Primers
Annealing temp.
Reading temp.
F: catcgtgactgttggtggag
R: tggcaatgctgtccatgtat
Complement C3
F: ctggagcagtcaaggtctacg
R: gctcaatggccatgatgtact
F: aacaccgatcctccaaacttc
R: tcgacattgttgagcacgtag
F: atacctcactccagcccactt
R: accatgtgctttaccaacagc
Fatty acid binding protein 5 (FABP5)
F: agttcagcagctggaaggaag
R: tgaaccaatgcaccatctgta
ATP-binding cassette A6 (ABCA6)
F: actcaccgtgaaggaaaacct
R: aagaccccaccttcttttcaa
Meltrin alpha
F: agtcaactcagcgagtgcttc
R: ggcacttggtgtggatattgt
ATP-binding cassette B4 (ABCB4)
F: ctcgatggtcaagaagcaaag
R: ttttgacctcctgagagctga
Acyl coenzyme A: cholesterol acyltransferase
F: ctgattccagaagccactgag
R: ctcttctgaggcaccctcttt
F: ccaaaaccctcatcaagacaa
R: gctcttagagaaggccagcac

rating: 0.00 from 0 votes | updated on: 16 Nov 2007 | views: 11020 |

Rate article:
