Login

Join for Free!
117057 members
table of contents table of contents

The goal of this study was to examine global alterations in gene …


Biology Articles » Biochemistry » Lipid Biochemistry » Alterations in lipid metabolism gene expression and abnormal lipid accumulation in fibroblast explants from giant axonal neuropathy patients » Tables

Tables
- Alterations in lipid metabolism gene expression and abnormal lipid accumulation in fibroblast explants from giant axonal neuropathy patients

Table 1

Differentially expressed genes in GAN vs. normal fibroblasts as analyzed by oligonucleotide microarrays. Genes selected displayed at least a three-fold difference in expression level.

Name
Acc. number
Fold change
Genes involved in lipid metabolism and adipogensis
Complement component 3 precursor
NM_000064.1
33.67
Butyrylcholinesterase
NM_000055
20.67
Alpha-2,8-sialyltransferase
L32867.1
6.95
Fatty acid binding protein 5
NM_001444.1
6.48
ATP-binding cassette A6
AA099357
4.38
Meltrin alpha
W46291
5.51
Adipsin
NM_001928.1
-7.39
ATP-binding cassette B4
NM_000443.2
-9.77
Acyl coenzyme A:cholesterol acyltransferase
S73751.1
-24.91
Leptin
NM_000230.1
-34.35



Integral membrane proteins and receptors
GABA-B receptor
AF056085.1
8.85
Integrin, beta 3
M35999.1
4.89
GABA-B receptor R2
AF095784.1
5.05
GABA-B receptor splice variant 1
AF095723.1
6.06
Orphan G protein-coupled receptor
AF069755.1
4.52
Integral membrane serine protease
U76833.1
4.63
Hyaluronan-mediated motility receptor
NM_012485.1
3.14
Death receptor 6
BE568134
-4.14
Endothelin receptor
M74921.1
-5.12
P-glycoprotein (mdr1)
AF016535.1
-7.95
Membrane glycoprotein M6
D49958.1
-5.82
C18ORF1
NM_004338.1
-4.19
Glycoprotein M6A
BF939489
-6.68
Potassium channel beta subunit
L39833.1
-5.44
Endothelin receptor type B
NM_003991.1
-8.89
Potassium channel beta 1a subunit
U33428.1
-3.99
E-cadherin
NM_004360.1
-7.04



Cell division/proliferation/apoptosis
Survivin
NM_001168.1
6.37
PDZ-binding kinase
NM_018492.1
4.38
Survivin-beta
AB028869.1
6.53
Mitosin (CENPF)
NM_005196.1
3.79
Dickkopf homolog 1
NM_012242.1
4.59
Kinetochore associated 2
NM_006101.1
3.51
Cell division cycle 2
AL524035
3.47
WNT4
NM_030761.1
-4.05
Fritz
U91903.1
-4.83
Tumor necrosis factor-related protein
NM_030945.1
-6.03
EGF-like-domain, multiple 6
NM_015507.2
-8.22



Transcription factors and nuclear proteins
Transcription factor AP-2 alpha
BF343007
7.41
High mobility group AT-hook 1
NM_002131.1
5.58
Nuclear factor IB
AI700518
4.49
Interferon-inducible protein p78
NM_002462.2
7.57



Cytoskeleton
Rabkinesin6
NM_005733.1
4.66
Stathmin-like 2
NM_007029.1
-5.32



Pregnancy specific beta-1-glycoprotein
Pregnancy specific beta-1-glycoprotein 7
NM_002783.1
-5.85
Pregnancy specific beta-1-glycoprotein 4
NM_002780.1
-17.82
Pregnancy specific beta-1-glycoprotein 1
NM_006905.1
-62.90



Uncharacterized genes
Hypothetical protein PRO02730
AL137654
10.56
Uncharacterized bone marrow protein
NM_018454.1
5.06
Hypothetical protein FLJ10517
NM_018123.1
5.74
KIAA0101 gene product
NM_014736.1
5.10
KIAA0008 gene product
NM_014750.1
4.62
Doublecortin and CaM kinase-like 1
NM_004734.1
4.53
KIAA1547 gene product
AW873621
3.96
Hypothetical protein DKFZp762E1312
NM_018410.1
4.54
Hypothetical protein FLJ10829
NM_018234.1
5.12
Clone HQ0310 PRO0310p1
NM_016359.1
4.38
Hypothetical protein DKFZp564H1916
AI186739
3.69
KIAA0042 gene product
NM_014875.1
4.96
Hypothetical protein FLJ22009
NM_024745.1
4.11
Hypothetical protein FLJ23468
NM_024629.1
3.48
Hypothetical protein DKFZp564N1116
BF344237
4.03
Hypothetical protein FLJ10781
NM_018215.1
-3.68
Myomegalin
AB042557.1
-4.97
Hypothetical protein DKFZp564B052
NM_030820.1
-5.46
KIAA0008 gene product
AK002054.1
-16.44
MGC:3052
BC002449.1
-7.73
KIAA0865 gene product
AI522028
-7.70



Miscellaneous
Matrix metalloproteinase 1
NM_002421.2
7.73
Carbonic anhydrase XII
NM_001218.2
7.80
Topoisomerase II alpha
AU159942
6.87
Step II splicing factor SLU7
AV733266
6.93
Monocyte chemotactic protein
S69738.1
4.37
Ribonucleotide reductase M2
BE966236
4.59
Plasminogen activator, urokinase
NM_002658.1
4.19
Cathepsin C
NM_001814.1
4.34
Atrophin-1 interacting protein 1
NM_012301.1
-3.89
Monoamine oxidase A
AA923354
-4.77
Type II iodothyronine deiodinase
U53506.1
-2.80
Phosphatidylserine-binding protein
NM_004657.1
-3.98
Scrapie responsive protein 1
NM_007281.1
-5.72
Natural killer cell transcript 4
NM_004221.1
-5.94
CD24 signal transducer
L33930
-9.16
Elastase 2
NM_001972.1
-9.71
CD24 antigen
AA761181
-19.19

Table 2

Quantitative RT-PCR conditions and gene-specific primer sequences.

Gene
Quantitative PCR Primers
Annealing temp.
Reading temp.
Gigaxonin
F: catcgtgactgttggtggag
R: tggcaatgctgtccatgtat
62°C
83°C
Complement C3
F: ctggagcagtcaaggtctacg
R: gctcaatggccatgatgtact
66°C
84°C
Butyrylcholinesterase
F: aacaccgatcctccaaacttc
R: tcgacattgttgagcacgtag
66°C
80°C
Sialyltransferase
F: atacctcactccagcccactt
R: accatgtgctttaccaacagc
66°C
80°C
Fatty acid binding protein 5 (FABP5)
F: agttcagcagctggaaggaag
R: tgaaccaatgcaccatctgta
68°C
83°C
ATP-binding cassette A6 (ABCA6)
F: actcaccgtgaaggaaaacct
R: aagaccccaccttcttttcaa
66°C
84°C
Meltrin alpha
F: agtcaactcagcgagtgcttc
R: ggcacttggtgtggatattgt
66°C
86°C
ATP-binding cassette B4 (ABCB4)
F: ctcgatggtcaagaagcaaag
R: ttttgacctcctgagagctga
66°C
84°C
Acyl coenzyme A: cholesterol acyltransferase
F: ctgattccagaagccactgag
R: ctcttctgaggcaccctcttt
66°C
85°C
Leptin
F: ccaaaaccctcatcaagacaa
R: gctcttagagaaggccagcac
66°C
86°C

rating: 0.00 from 0 votes | updated on: 16 Nov 2007 | views: 7746 |

Rate article:







excellent!bad…